Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels. Many neurodegenerative diseases are accompanied by cognitive impairment associated with the dysfunction of nAChRs. The human membrane-tethered prototoxin Lynx1 modulates nAChR function in the brain areas responsible for learning and memory. In this study, we have demonstrated for the first time that the ?-amyloid peptide A? 1-42 decreases Lynx1 mRNA expression in rat primary cortical neurons, and that this decrease is associated with the activation of c-Jun N-terminal kinase (JNK). In addition, we have demonstrated that the Lynx1 expression decrease, as well as the blockade of the long-term potentiation underlying learning and memory, caused by A? 1-42, may be prevented by incubation with a water-soluble Lynx1 analogue. Our findings suggest that the water-soluble Lynx1 analogue may be a promising agent for the improvement of cognitive deficits in neurodegenerative diseases.

Анотація наукової статті з біотехнологій в медицині, автор наукової роботи - Bychkov M.L., Vasilyeva N.A., Shulepko M.A., Balaban P.M., Kirpichnikov M.P.


Область наук:

  • Біотехнології в медицині

  • Рік видавництва: 2018


    Журнал: Acta Naturae (англомовна версія)


    Наукова стаття на тему 'LYNX1 PREVENTS LONG-TERM POTENTIATION BLOCKADE AND REDUCTION OF NEUROMODULATOR EXPRESSION CAUSED BY A? 1-42 AND JNK ACTIVATION'

    Текст наукової роботи на тему «LYNX1 PREVENTS LONG-TERM POTENTIATION BLOCKADE AND REDUCTION OF NEUROMODULATOR EXPRESSION CAUSED BY A? 1-42 AND JNK ACTIVATION»

    ?Lynx1 Prevents Long-Term Potentiation Blockade and Reduction of Neuromodulator Expression Caused by AP1-42 and JNK Activation

    M. L. Bychkov12, N. A. Vasilyeva1, M. A. Shulepko12, P. M. Balaban3, M. P. Kirpichnikov12, E. N. Lyukmanova1,2 *

    1Lomonosov Moscow State University, Leninskie Gori 1, Moscow, 119234, Russia 2Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Miklucho-Maklaya Str., 16/10, Moscow, 117997, Russia

    institute of Higher Nervous Activity and Neurophysiology, Russian Academy of Sciences, Butlerova Str., 5A, Moscow, 117485, Russia * E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.. Received March 18, 2018; in final form June 27, 2018

    Copyright © 2018 Park-media, Ltd. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

    ABSTRACT Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels. Many neurodegenerative diseases are accompanied by cognitive impairment associated with the dysfunction of nAChRs. The human membrane-tethered prototoxin Lynxl modulates nAChR function in the brain areas responsible for learning and memory. In this study, we have demonstrated for the first time that the P-amyloid peptide AP1 42 decreases Lynxl mRNA expression in rat primary cortical neurons, and that this decrease is associated with the activation of c-Jun N-terminal kinase (JNK). In addition, we have demonstrated that the Lynxl expression decrease, as well as the blockade of the long-term potentiation underlying learning and memory, caused by AP1 42 may be prevented by incubation with a water-soluble Lynxl analogue. Our findings suggest that the water-soluble Lynxl analogue may be a promising agent for the improvement of cognitive deficits in neurodegenerative diseases. KEYWORDS nicotinic acetylcholine receptor, cognitive impairment, Alzheimer disease, P-amyloid peptide, Ly6 / uPAR.

    ABBREVIATIONS ACSF - artificial cerebrospinal fluid, AD - Alzheimer disease, HFS - high-frequency stimulation, LTP - long-term potentiation, fEPSPs - field excitatory postsynaptic potentials, AP - P-amyloid peptide, nAChR - nicotinic acetylcholine receptor, siRNA - small interfering RNA, ws-Lynxl - water-soluble Lynxl.

    INTRODUCTION

    Many neurodegenerative diseases, such as Alzheimer's disease (AD), are characterized by impaired cognitive processes associated with the dysfunction of nicotinic acetylcholine receptors (nAChRs) [1]. In AD, oligomers of the P-amyloid peptide (AP) form plaques and the most toxic AP is AP1-42 [1]. AP1-42 in a 200 nM concentration inhibits a7-nAChR, the most common nicotinic cholinergic receptor in the brain; and the interaction between AP and the receptor leads to internalization of the latter in AD [1]. In addition, AP inhibits the long-term potentiation (LTP) [2] that is a generally established model for the plasticity processes underlying memory and learning [3].

    Previously, we demonstrated that a water-soluble variant of the human protein Lynx1 (ws-Lynx1) [4],

    which modulates the a7-nAChR function in the brain [5], competes with AP142 for binding to a7-nAChR [6]. Pre-incubation of mouse cortical neurons with ws-Lynx1 was shown to reduce the cytotoxic effect of AP142 [6]. In addition, Western blot analysis revealed a reduced Lynx1 expression in the cortex of AD modeling transgenic mice (3xTg-AD) compared to wild-type mice [6]. Based on these facts, we argue that Lynx1 plays an important role in AD, and that the accumulation of AP142 down-regulates the expression of this neuromodulator in the brain and disturbs the AP1 / Lynx1 balance, causing a7-nAChR dysfunction. We studied the effect of AP142 on Lynxl gene expression in rat primary cortical and hippocampal neurons and evaluated the effect of ws-Lynx1 and AP142 on LTP in mouse hippocampal slices.

    EXPERIMENTAL

    A primary neuron culture was prepared from the cortex and hippocampus of newborn Wistar rats according to the previously described procedure [7]. On the 14th day, the neuron culture was supplemented with either AP: 42 (1 or 5 | M, Biopeptide Co) oligomerized according to the previously described protocol [8], or 5 | M AP421 (reverse peptide used as a negative control; Biopeptide Co), or 10 | M ws-Lynx1 (prepared according to [4]), or a mixture (5 | M AP142 + 10 | M ws-Lynx1), or 2.5 | M SP600125 (Tocris), or a mixture ( 5 | M AP1-42 + 2.5 | M SP600125) and incubated for an additional 24 h. For JNK knockdown, on the 10th day cortical neurons were transfected with JNK1 and JNK2 small interfering RNAs (siRNAs) or with the control siRNA (Table 1). After that, the neurons were incubated for 72 h, then they were supplemented with 5 | M AP1-42 and incubated for another 24 h.

    Then, the total mRNA was isolated using an Extrac-tRNA reagent (Evrogen). The mRNA was treated with DNase I (Thermo Fisher Scientific, USA), and cDNA was then synthesized using a MMLV RT kit (Evrogen). Real-time PCR was carried out using a 5x mixture of qPCRmix-HS SYBR + HighROX (Evrogen); the list of primers is given in Table 2. The data were analyzed using the LinReg 2017.0 software. The mRNA level was normalized to the P-actin values.

    Transversal hippocampal slices from eight-month-old C57BL / 6 mice were perfused with an artificial cerebrospinal fluid (ACSF) (124 mM NaCl, 3 mM KCl, 2.5 mM CaCl2, 1.3 mM MgCl2, 26 mM NaHCO3, 1.27 mM NaH2PO4, and 10 mM D-glucose, pH 7.4), continuously saturated with carbogen (95% O2 + 5% CO2) at 34 ° C for 1 h. Then, a portion of the slices was perfused with ACSF containing 200 nM AP1-42 and the other was perfused with ACSF containing12-4020 nM AP1-42 + 2 | M ws-Lynx1 for 1 h. Control slices were perfused with ACSF without AP: 42 and ws-Lynx1. Field excitatory postsyn-aptic potentials (fEPSPs) were recorded using a Slice-Master system (Scientifica, UK) at 32 ° C. A recording electrode (1-3 MD) filled with ACSF was positioned within hippocampal CA1 stratum radiatum. Synaptic responses were evoked by paired-pulse stimulation of Schaffer collaterals in the CA3 stratum radiatum area by using a bipolar electrode. A 50-ms interpulse interval was used, unless stated otherwise. The simulations

    Table 1. The small interfering RNAs used in the study

    Gene Interfering RNA sequence

    Control UUCUCCGAACGUGUCACGUTT

    ACGUGACACGUUCGGAGAATT

    JNK1 GGCAUGGGCUAUAAAGAAATT

    UUUCUUUGUAGCCCAUGCCTT

    JNK2 GCCAGAGACUUAUUAUCAATT

    UUGAUAAUAAGUCUCUGGCTT

    were repeated at 0.033 Hz. Stimulus intensity was adjusted to elicit 40% of maximal fEPSP amplitude.

    After 20 minutes of recording test responses, a high-frequency stimulation (HFS) protocol was used to induce LTP: 10 trains with a frequency of 100 Hz (five stimuli per train) with an intertrain interval of 200 ms, four sessions with an interval of 30 s. After LTP induction, fEPSPs were recorded for 1.5 h. The obtained data were recorded, filtered, and analyzed using the Spike2 software (Cambridge Electronic Design Limited, UK) and SigmaPlot 11.0 (Systat Software Inc., USA). The post-tetanic tangent of the fEPSP slope was normalized to the mean slope of all fEPSPs recorded 20 min before LTP induction.

    The statistical analysis of the LTP data and the data on the effect of AP1-42, ws-Lynx1, SP600125, and siRNA on gene expression in primary neurons was performed using the GraphPad Prism 6.0 (GraphPad Software Inc.) software. A value of p < 0.05 was considered statistically significant. All experiments were performed in accordance with the guidelines set forth by the European Communities Council Directive of November 24, 1986 (86/609 / EEC) and were approved by the ethical committees of the Shemyakin-Ovchinnikov Institute and Institute of Higher Nervous Activity and Neu -rophysiology, Russian Academy of Sciences.

    RESULTS AND DISCUSSION

    AP142-induced decrease in Lynxl expression in neurons is associated with JNK activation

    To test the hypothesis of the effect of amyloid peptide on Lynx1 expression, we incubated primary neurons of the rat cortex and hippocampus with 1 | M of oli-

    Table 2. Primers used in the study

    Gene Forward primer Reverse primer Length, bp

    ?-actin TCATGTTTGAGACCTTCAACAC GTCTTTGCGGATGTCCACG 250

    Lynxl ACCACTCGAACTTACTTCACC ATCGTACACGGTCTCAAAGC 81

    a7-nAChR TGCACGTGTCCCTGCAAGGC GTACACGGTGAGCGGCTGCG 112

    Control

    120. 110. 1009080. 70. 60-

    50

    A

    Lynxl

    Hippocampal

    Cortical neurons

    1 mM AP,

    120. 110100 -90 80 70 60

    ID >

    <C z

    IX

    50

    a7-nAChR

    Hippocampal

    Cortical

    Fig. 1. Effect of AP142 on Lynxl (A) and a7-nAChR (B) gene expression in primary cortical and hippocampal neurons. The data are presented as% of the control ± s.e.m. (N = 3). Data indicated by * (p<0.05) significantly differ from each other, based on a two-sided t-test

    B

    neurons

    neurons

    neurons

    gomeric AP1-42 and analyzed the Lynxl mRNA level (Fig. 1A). In hippocampal neurons, there was no significant decrease in neuromodulator expression, while a significant reduction in the Lynxl mRNA level (up to 78.4 ± 4.4% of the control level) was observed in cortical neurons. This is consistent with a previously observed decrease in Lynx1 expression in the cortex of AD modeling mice [6]. In contrast, AP1-42 did not decrease the a7-nAChR mRNA level either in hippocampal or in cortical neurons (Fig. 1B). An increase in the AP142 concentration to 5 led to a further decrease in Lynxl gene expression in cortical neurons (up to 65.8 ± 4.9% of the control level, Fig. 2A).

    Nicotine-induced activation of a7-nAChR can regulate gene transcription through CREB phosphorylation and the activation of MAP / ERK signaling pathways, which is accompanied by an increase in the expression level of the early response c-Fos transcription factor [9]. On the other hand, binding of oligomeric AP142 to a7-nAChR leads to the activation of c-Jun N-terminal kinase (JNK) [10], which plays a key role in the regulation of gene expression and other vital processes, including processing of the P-amyloid peptide precursor and formation of neurofibrillary tangles in AD [10]. In turn, JNK activation may lead to the inhibition of CREB transcription factor phosphorylation and, therefore, to a decrease in the expression level of the c-Fos transcription factor [11].

    To elucidate whether the decreased Lynxl expression level in cortical neurons incubated with oligo-meric AP1-42 was associated with JNK activation, we incubated cortical neurons with AP142 and SP600125, a selective inhibitor of JNK1, JNK2, and JNK3 which

    is considered now as one of the potential drugs for AD treatment [10]. Indeed, co-incubation of neurons with AP142 and SP600125 prevented the decrease in Lynxl expression, indicating a possible association of this decrease with JNK activation (Fig. 2B). To confirm the role of JNK in the regulation of Lynxl transcription, we used knockdown of the JNKl and JNK2 genes with small interfering RNAs. As expected, incubation of neurons with blocked JNKl and JNK2 expression in the presence of AP1-42 led to a recovery of the Lynxl mRNA expression level (Fig. 2B). In this case, transfec-tion of the neuronal culture with control siRNA that did not inhibit gene transcription had no effect on the decrease in Lynxl mRNA expression caused by AP1-42 (data not shown). Knockdown of JNKl and JNK2 in the absence of AP1-42 did not cause significant changes in the Lynxl expression level (Fig. 2B), which confirms the association of the amyloid peptide, JNK activation, and decreased neuromodulator transcription.

    An analysis of the human LYNXl gene promoter in the human genome browser (chr8: 143841246 -chr8: 143879640) and the mouse Lynxl gene promoter (chr15: 74573409 - chr15: 74603409) revealed two potential binding sites for the AP-1 transcriptional complex formed by the c-Jun and c-Fos transcription factors (Fig. 2C). AP142-induced activation of JNK is simultaneously accompanied by c-Jun activation [10] and c-Fos down-regulation [11]. For that reason, a possible imbalance between c-Jun and c-Fos can cause a disruption in the AP-1 transcriptional complex formation and lead to the decrease in Lynxl gene transcription. In accordance with this suggestion, incubation of cortical neurons together with ws-Lynx1 and AP1-42 was

    A

    120

    110

    100

    ID

    > 90

    < z 80

    X

    ? 70

    60

    50

    C

    Hippocampal neurons

    Cortical neurons

    c

    o U

    <

    CO <

    i- _

    c

    o U

    <

    CO <

    ,1 x * $

    i 1

    LO O +

    120 110 ^ 100

    <u >

    jy <

    z

    X

    90 80 70 60 50

    Cortical neurons

    L a

    c

    o U

    CO <

    5 2 01

    0

    6

    Q-

    00

    AO

    1ft «+

    X

    CO

    X

    +

    143.841.246

    Lynxl promoter

    143.879.640

    _I

    AP-1

    Fig.2. Ws-Lynx1 and JNK inhibition cancels the decrease in Lynxl expression in a primary culture of cortical neurons treated with AP1. (A) Effect of AP142, AP421, and ws-Lynx1 on Lynxl expression. (6) Effect of AP1, JNK inhibition by SP600125, and knockdown of the JNK1 and JNK2 genes on Lynxl expression. The data are presented as% of the control ± s.e.m. (N = 4). Data indicated by * (p < 0.05), ** (p < 0.01), and **** (p < 0.0001) mean a statistically significant difference between groups according to the one-sided ANOVA test, followed by the Tukey's / hoc test. (C) Schematic structure of the Lynxl gene. Red lines denote the c-Jun and c-Fos binding sites.

    B

    accompanied by recovery of the Lynxl mRNA level (Fig. 2B). Apparently, ws-Lynx1 competes with A? 1 42 for binding to a7-nAChR [6] and activates a7-nAChR in a nicotine-like manner, which leads to the c-Fos up-regulation [9] and recovery of Lynxl transcription.

    Ws-Lynx1 prevents A? T 42-induced LTP blockade

    Using SP600125, it was previously demonstrated that the LTP blockade observed during the incubation of hippocampal slices with oligomeric A? 1 42 was associated with JNK activation [12]. To study the effect of Lynxl on the recovery of the synaptic plasticity impaired by the interaction between oligomeric A? 142 and a7-nA-ChR, as well as JNK activation, we investigated the influence of 200 nM A? 142 on LTP in the surviving mouse's hippocampal slices in the presence and absence of 2 ws-Lynxl. Pre-perfusion of the slices in a solution containing A? 142 for 1 h led to a significant decrease in the

    post-tetanic fEPSP, noticeable in the first minutes after LTP induction. In this case, the fEPSP slope averaged over the first 10 minutes of recording decreased almost 1.5-fold compared to the control fEPSP slope (Fig. 3B). A significant decrease in the fEPSP slope caused by AP1-42 to the baseline fEPSP values ​​was observed during the entire period after LTP induction.

    However, incubation of hippocampal slices in a medium containing both AP1-42 and ws-Lynx1 restored the LTP level almost to the control values ​​(Fig. 3). The mean fEPSP slope upon simultaneous application of AP1-42 and ws-Lynx1 was significantly higher than that of the fEPSP observed during incubation with AP1-42 alone and was not statistically different from the mean fEPSP slope in the control throughout the recording time after HFS (Fig. 3B). Therefore, ws-Lynx1 prevents the inhibitory effect of AP1-42 and facilitates the complete recovery of LTP.

    A

    0.2 mV ^ 20 ms

    2.5 -

    Control 200 nM A ?, 42 A ?, 42 + Lynxl

    # Control ® 200 nM A ?, 42

    O A?, _ 42 + Lynxl

    "T

    20

    r

    40

    T

    60

    T

    80

    Time, min

    <u a. o

    Q-

    on

    Q-

    1

    Control

    200 nM A?, _ 42 m A?, _ 42 + Lynxl

    2

    * ^ '-' i

    *

    1-1 *

    J- 'I

    0-10 80-90

    Time after HFS, min

    Fig. 3. Ws-Lynx1 prevents AP, 42-induced LTP blockade in hippocampal slices. (A) Time course of changes in the fEPSP slope recorded in control hippocampal slices perfused with ACSF without AP, 42 (n = 8), ACSF containing 200 nM AP, 42 (n = 6), and ACSF containing 200 nM AP, 42 + 2 pM ws-Lynx1 (n = 5). (6) fEPSPs slopes averaged during 0-10 min and 80-90 min after HFS. * (P < 0.05) means a statistically significant difference between groups according to the one-way ANOVA test, followed by the Tukey's / hoc test

    B

    0

    CONCLUSION

    Hereby, the presence of oligomeric AP1 42 in the neuronal environment leads to a significant decrease in the expression of the Lynxl neuromodulator that regulates a7-nAChR functioning in the brain. We have demonstrated for the first time that this decrease is associated with JNK activation and can be prevented by incubation with the water-soluble Lynxl analogue. In addition, ws-Lynxl is capable of correcting AP142-induced impairments of hippocampal synaptic plasticity, which

    underlies memory impairment and other cognitive dysfunctions in AD.

    This work was supported by the Russian Foundation

    for Basic Research (No. 16-34-01302; N.A.V., development of a system for registering currents in

    brain slices) and Russian Science Foundation (No. 16-14-00102; E.N.L., M.A.Sh, N.A.V, effects of APUi2, SP600125, siRNA, and ws-Lynx1 on LTP and gene expression).

    REFERENCES

    1. Buckingham S.D., Jones A.K., Brown L.A., Sattelle D.B. // Pharmacol. Rev. 2009. V. 61. P. 39-61.

    2. Walsh D.M., Klyubin I., Fadeeva J.V., Cullen W.K., Anwyl R., Wolfe M.S., Rowan M.J., Selkoe D.J. // Nature. 2002.

    V. 416. P. 535-539.

    3. Lynch M.A. // Physiol. Rev. 2004. V. 84. P. 87-136.

    4. Lyukmanova E.N., Shenkarev Z.O., Shulepko M.A., Mi-neev K.S., D'Hoedt D., Kasheverov I.E., Filkin S.Y., Krivola-pova A.P., Janickova H., Dolezal V., Dolgikh D.A., et al. // J. Biol. Chem. 2011. V. 286. P. 10618-10627.

    5. Miwa J.M., Ibanez-Tallon I., Crabtree G.W., Sanchez R., Sali A., Role L.W., Heintz N. // Neuron. 1999. V. 23. P. 105-114.

    6. Thomsen M.S., Arvaniti M., Jensen M.M., Shulepko M.A., Dolgikh D.A., Pinborg L.H., Hartig W., Lyukmanova E.N.,

    Mikkelsen J.D. // Neurobiol. Aging. 2016. V. 46. P. 13-21.

    7. Suntsova M., Gogvadze E.V., Salozhin S., Gaifullin N., Ero-shkin F., Dmitriev S.E., Martynova N., Kulikov K., Malak-hova G., Tukhbatova G., et al. // Proc. Natl. Acad. Sci. USA. 2013. V. 110. P. 19472-19477.

    8. Klein W.L. // Neurochem. Int. 2002. V. 41. P. 345-352.

    9. Hu M., Liu Q.S., Chang K.T., Berg D.K. // Mol. Cell. Neuro-sci. 2002. V. 21. P. 616-625.

    10. Yarza R., Vela S., Solas M., Ramirez M.J. // Front. Pharmacol. 2016. V. 6 doi: 10.3389 / fphar.2015.00321.

    11. Yenki P., Khodagholi F., Shaerzadeh F. // J. Mol. Neurosci. 2013. V. 49. P. 262-269.

    12. Wang Q., Walsh D.M., Rowan M.J., Selkoe D.J., Anwyl R. // J. Neurosci. 2004. V. 24. P. 3370-3378.


    Ключові слова: NICOTINIC ACETYLCHOLINE RECEPTOR /COGNITIVE IMPAIRMENT /ALZHEIMER DISEASE /?-AMYLOID PEPTIDE /LY6 / UPAR

    Завантажити оригінал статті:

    Завантажити