Поліаміни присутні у всіх живих клітинах і регулюють широкий спектр біологічних процесів. У дріжджів Saccharomyces cerevisiae поліаміноксідаза Fms1p перетворює спермін в спермидин і 3-амінопропаналь, що необхідно для синтезу пантотенової кислоти і гіпузінірованія. У даній роботі показано, що ортологи гена FMS1 дріжджів S. cerevisiae присутні у всіх основних представників підвідділу Saccharomycotina, проте їх копийность різна. У дріжджів Komagataella рhaffii (Pichia pastoris) Ідентифіковані два гена поліаміноксідаз (KpFMS1 і KpFMS2) і вивчена регуляція активності їх промоторів.

Анотація наукової статті з біологічних наук, автор наукової роботи - Іванова Аліна Владиславівна, Сидорин Антон Віталійович, Самбук Олена Вікторівна, Румянцев Андрій Михайлович


The analysis of the polyamine oxidase genes in the methylotrophic yeast Komagataella phaffii

Polyamines are present in all living cells and regulate a wide range of biological processes. In Saccharomyces cerevisiae the polyamine oxidase Fms1p converts spermine to spermidine and 3-aminopropionaldehyde, which is necessary for the synthesis of pantothenic acid and hypusination. This paper shows that S. cerevisiae FMS1 gene orthologs are present in all major representatives of the Saccharomycotina subdivision, but their copy numbers are different. In the Komagataella phaffii (Pichia pastoris) Yeast, two polyamine oxidase genes (KpFMS1 and KpFMS2) were identified, and the regulation of their promoters activity was studied.


Область наук:
  • біологічні науки
  • Рік видавництва: 2019
    Журнал: екологічна генетика

    Наукова стаття на тему 'АНАЛІЗ ГЕНОВ ПОЛІАМІНОКСІДАЗ У метилотрофних дріжджів KOMAGATAELLA PHAFFII'

    Текст наукової роботи на тему «АНАЛІЗ ГЕНОВ ПОЛІАМІНОКСІДАЗ У метилотрофних дріжджів KOMAGATAELLA PHAFFII»

    ?'W) Check for updates

    https://doi.org/l0.17816/ecogen17447-55

    АНАЛІЗ ГЕНОВ ПОЛІАМІНОКСІДАЗ У метилотрофних дріжджів KOMAGATAELLA PHAFFII

    © А.В. Іванова, А.В. Сидорин, Е.В. Самбук, А.М. Румянцев

    ФГБОУ ВО «Санкт-Петербурзький державний університет», Санкт-Петербург

    Для цитування: Іванова А.В., Сидорин А.В., Самбук Є.В., Румянцев А.М. Аналіз генів поліаміноксідаз у метилотрофних дріжджів Komagataella phaffii // Екологічна генетика. - 2019. - Т. 17. - № 4. - С. 47-55. https://doi.org/l0.17816/ecogen17447-55.

    Надійшла: 17.06.2019 Схвалено: 02.12.2019 Прийнята: 17.12.2019

    Ф Поліаміни присутні у всіх живих клітинах і регулюють широкий спектр біологічних процесів. У дріжджів Saccharomyces cerevisiae поліаміноксідаза Fms1p перетворює спермін в спермидин і 3-амінопропаналь, що необхідно для синтезу пантотенової кислоти і гіпузінірованія. У даній роботі показано, що ортологи гена FMS1 дріжджів S. cerevisiae присутні у всіх основних представників підвідділу Saccharomycotina, проте їх копийность різна. У дріжджів Komagataella phaffii (Pichia pastoris) ідентифіковані два гена поліаміноксідаз (KpFMSl і KpFMS2) і вивчена регуляція активності їх промоторів.

    Ф Ключові слова: поліаміноксідази; метилотрофні дріжджі; Komagataella phaffii; Pichia pastoris.

    THE ANALYSIS OF THE POLYAMINE OXIDASE GENES IN THE METHYLOTROPHIC YEAST

    KOMAGATAELLA PHAFFII

    © A.V. Ivanova, A.V. Sidorin, E.V. Sambuk, A.M. Rumyantsev

    St. Petersburg State University, Saint Petersburg, Russia

    Cite this article as: Ivanova AV, Sidorin AV Sambuk EV, Rumyantsev AM. The analysis of the polyamine oxidase genes in the methylotrophic yeast Komagataella phaffii. Ecological genetics. 2019; 17 (4): 47-55. https://doi.org/l0.17816/ecogen17447-55.

    Received: 17.06.2019 Revised: 02.12.2019 Accepted: 17.12.2019

    & Polyamines are present in all living cells and regulate a wide range of biological processes. In Saccharomyces cerevisiae the polyamine oxidase Fmslp converts spermine to spermidine and 3-aminopropionaldehyde, which is necessary for the synthesis of pantothenic acid and hypusination. This paper shows that S. cerevisiae FMS1 gene orthologs are present in all major representatives of the Saccharomycotina subdivision, but their copy numbers are different. In the Komagataella phaffii (Pichia pastoris) yeast, two polyamine oxidase genes (KpFMS1 and KpFMS2) were identified, and the regulation of their promoters activity was studied.

    & Keywords: polyamine oxidases; methylotrophic yeast; Komagataella phaffii; Pichia pastoris.

    ВСТУП

    Поліаміни - група аліфатичних полікатіонов, яка виявлена ​​у прокариотических і еукаріоти-чеських організмів. У вищих еукаріот, в тому числі і у грибів, найбільш часто зустрічаються путресцин, спермидин і спермін. Функції поліамінів визначаються їх хімічною структурою. При фізіологічних рН поліаміни мають позитивний заряд і за рахунок електростатичних і гідрофобних взаємодій можуть діяти як ліганди, зв'язуючись з ДНК, РНК, білками, фосфоліпідами і нуклеозідтрі-фосфатами [1, 2]. Припускають, що поліаміни можуть брати участь в регуляції експресії генів як за рахунок зміни структури ДНК і модуляції сигнальних шляхів, так і за рахунок зв'язування з транскрипційними факторами. Поліаміни надлишкові у всіх живих організмів. Дефіцит поліамінів призводить до припинення росту клітин, однак їх інтенсивне накопичення може

    бути Цитотоксичність, що свідчить про необхідність суворої регуляції внутрішньоклітинного пулу цих сполук [2, 3]. Останнім часом інтерес до полиаминам викликаний їх можливим використанням в якості антипроліферативних з'єднань.

    Рівень поліамінів в клітині контролюється комплексом биосинтетических (орнітиндекарбоксилази, S-аденозілметіонінкарбоксілаза, спермідінсінта через та спермінсінтаза) і катаболічних (спермидин / спермінацетілтрансфераза, флавінсодержащая поліаміноксідаза, Сі-яка містить діаміноксидазу) ферментів [2]. Поліаміноксідаза представляє особливий інтерес, тому що вона перетворює спермін в спермидин і 3-амінопропаналь. Окислення 3-амінопропаналя необхідно 5. cerevisiae для синтезу пантотенової кислоти [4], в той час як спермидин бере участь в реакції гіпузінірованія (важливою модифікації трансляційного фактора е№-5А) [5].

    Філогенетичний аналіз поліаміноксідаз був проведений у тварин і рослин. У тварин виявлено, що в процесі еволюції предковий ген полі-аміноксідази PAO був дупліціроваться, і в результаті виникли два білка Паралогія хребетних, які кодуються генами SMO ​​і APAO [6]. Геном Arabidopsis thaliana містить мінімум п'ять поліаміноксідаз. Аналіз субстратної специфічності білка показав, що полі-аміноксідаза AtPAO3 окисляє спермидин і спермін і продукує H2O2. Показано, що поліаміноксіда-зи рослин A. thaliana AtPAO2, AtPAO3 і AtPAO4 локалізовані в пероксисомах [7]. У тварин один з білків поліаміноксідаз містить сигнал транспорту в пероксисоми і також може бути локалізована в цих органелах.

    У грибів поліаміни регулюють широке коло біологічних явищ: диморфізм, формування суперечка і апрессорій. У деяких випадках вони регулюють вірулентність грибів - патогенів тварин і рослин [8]. Найкраще вивчена ФАД-залежна (флавінаденіндінуклеотід) поліаміноксідаза Fms ^ Saccharomyces cerevisiae [9], що бере участь в біосинтезі Р-аланіну і пантотенової кислоти. Дріжджі c делецией гена FMS1 не здатні рости на середовищі без пантотенової кислоти або р-аланіну, а в разі надекспресія гена FMS1 під контролем ADH1 промотора, трансформанти секретують пантотенову кислоту в середу [4]. У той же час у інших представників підвідділу Saccharomycotina кількість генів поліаміноксідаз варіює і зв'язок копийности генів полі-амінооксідаз з метаболізмом не ясна.

    У даній роботі проведено аналіз Ортолог поліаміноксідаз у представників підвідділу Saccharomy-cotina, ідентифіковані гени поліаміноксідаз KpFMS1 і KpFMS2 метилотрофних дріжджів Koma-gataella рhaffii (Pichia pastoris) і вивчена їх регуляція.

    МАТЕРІАЛИ ТА МЕТОДИ

    Порівняння амінокислотних послідовностей поліаміноксідаз

    Ортологи білка S. cerevisiae Fmslp у представників групи Saccharomycotina були знайдені за допомогою алгоритму BLASTp зі стандартними параметрами [10]. Множинне порівняння амінокислотних послідовностей поліаміноксідаз проводили в програмі Mega X [11]. Знайдені послідовності були ви-одно за допомогою програми CLUSTAL W [12]. Для побудови філогенетичного дерева використовували метод Maximum Likelihood (ML). Найкращою моделлю для даного методу виявилася LG + G [13]. Побудова ML дерева проводилося з використанням моделі LG + G і з 500 повторний аналіз bootstrap. Отримане дерево було вкорінене за допомогою зовнішньої групи - грибів Neurospora crassa. візуалізували

    дерево за допомогою програми FigTree v1.4.3 (http: // influenza.bio.ed.ac.uk/software/Figtree/).

    праймери

    Все праймери, використані в роботі, представлені в табл. 1.

    Таблиця 1

    Послідовності праймерів, використаних в роботі

    Назва Послідовність (5 '^ 3')

    KpFMS1F AAAGACGTCAGGGTACACGGTATTGTGAGA

    KpFMS1R AATGGATCCTGATAGCCGATTGCAATGTT

    KpFMS2F AAAAAGACGTCGTTTCGAATAATTAGTTGTT

    KpFMS2R AATGGATCCGTTGGTATTGTGAAATAGACG

    PHO5R CGGAATTCCAAAACTATTGT

    плазміди

    У роботі були використані плазміди pAL2-T (Євро-ген, Росія) і pPIC9-AOX1-PHO5 [14].

    штами

    У роботі були використані штами дріжджів К. phaffii 4-GS115 (his4 phox) і tr2-4-GS115 (phox PAOX1-PHO5) [14], а також штам бактерій E. coli DH5a, (fhuA2 A (argF-lacZ) U169 phoA glnV44 Ф80А (lacZ) M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17).

    Середовища і умови культивування

    Для культивування штамів дріжджів використовували такі середовища. YEPD: 2% глюкоза, 2% пептони, 1% дріжджовий екстракт, 2.4% агар. МФО: 0.73 М MgSO4 • 7H2O, 0.18 мМ CaCl2, 20 мМ Na-цитратний буфер (pH 4,6), вітаміни, мікроелементи. Джерела вуглецю (гліцерин або метанол) - 1%, джерело азоту (сульфат амонію) - 0,2%. Для культивування бактерій використовували середу LB: 1% триптон, 0.5% дріжджовий екстракт, 170 мМ NaCl, бензилпенициллин - 5 • 105 е. А. / Л. Штами К. phaffii вирощували при температурі 30 ° C, E. coli - при температурі 37 ° C.

    Конструювання плазмід pPIC9-PKpFMS1-PHO5 і pPIC9-PKpFMS2-PHO5

    Для отримання плазмід pPIC9-PKpFMS1-PHO5 і pPIC9-PKpFMS2-PHO5 проводили полімеразну ланцюгову реакцію (ПЛР) з праймерами до промотор генів KpFMS1 (KpFMS1F і KpFMS 1R) і KpFMS2 (KpFMS2F і KpFMS2R) і хромосомної ДНК штаму К. phaffii 4-GS115 в якості матриці. Виділення хромосомної ДНК з клітин дріжджів проводили згідно [15]. Послідовності промоторів були клоновані в отриманий раніше вектор pPIC9-PHO5 [14] з використанням сайтів рестрикції AatII і BamHI.

    При цьому відбувалося заміщення промотора гена ал-когольоксідази 1 AOXl на промотори генів поліаміноксідаз KpFMSl і KpFMS2. Трансформацію бактерій проводили згідно [16]. В результаті були сконструйовані плазміди, в яких під контролем промоторів генів KpFMSl і KpFMS2 знаходяться послідовності репортерного гена кислої фосфатази (КФ) PHO5 дріжджів S. cerevisiae. Також ці плазміди містять ген HIS4 як селективного маркера.

    Структуру підсумкових плазмід pPIC9-PKpFMS1-PHO5 і pPIC9-PKpFMS2-PHO5 перевіряли за допомогою методів ПЛР і рестрикционного аналізу.

    Отримання штамів РFMS1-4-GS115 і РFMS2-4-GS115

    Плазмідами pPIC9-PKpFMS 1-PHO5 і pPIC9-PKpFMS2-PHO5 трансформували штам 4-GS115. Для цього плазміди лінеаризоване за допомогою ендо- нуклеази рестрикції StuI і трансформували клітини дріжджів методом електропорації [17]. При цьому відбувалася інтеграція генетичної конструкції в геном K. phaffii. Селекцію трансформантов проводили за рахунок відновлення прототрофності по гістидину. Для аналізу інтеграції плазміди виділяли хромосомну ДНК з трансформантов і проводили ПЛР з праймера-ми до промотор генів поліаміноксідаз і гену PHO5 (KpFMS1F і PHO5R для PFMS1-4-GS115; KpFMS2F і PHO5R для PFMS2-4-GS115).

    молекулярні методи

    Гідроліз ДНК ендонуклеаза рестрикції BamHI, AatII і StuI виробляли за умов, запропонованих фірмою-виробником ферментів (Thermo Fisher Scientific Inc., США). Дефосфорілірованіе вектора виробляли за допомогою фосфатази FastAP (Thermo Fisher Scientific Inc., США) одночасно з гідролізом ДНК ендонуклеаза рестрикції. Очищення ДНК з ага-різни гелів і реакційних сумішей проводили за допомогою наборів Cleanup Standard (ЄВРОГЕН, Росія). Лі-гірованіе фрагментів ДНК проводили за допомогою T4 ДНК лігази (ЄВРОГЕН, Росія). Виділення плазмідної ДНК проводили за допомогою наборів Plasmid Miniprep (ЄВРОГЕН, Росія). Для проведення ПЛР використовували набори реактивів Encyclo Plus PCR (ЄВРОГЕН, Росія). Електрофорез фрагментів ДНК проводили в 0,7% агарозному гелі в буфері TAE [18].

    Якісне визначення активності кислої фосфатази

    На поверхню середовища з виросли колоніями дріжджів накладали паперові фільтри, змочені розчином субстрату а-нафтілфосфата і барвника синього міцного Б, розчинених в 0,1 М цитратного буфера рН 4,6 до концентрації 2 мг / мл. Через 10 хв оцінювали інтенсивність фарбування колоній дріжджів [19].

    РЕЗУЛЬТАТИ

    1. Біоінформатіческій аналіз протеома дріжджів підвідділу Saccharomycotina

    На першому етапі роботи вивчили поширеність поліаміноксідаз серед основних представників підвідділу Saccharomycotina (відділ Ascomycota). Для цього за допомогою алгоритму BLAST провели пошук гомологічних білків в протеома 22 видів дріжджів, що відносяться до різних родин даного відділу, а також в протеома міцеліальні гриба Neurospora crassa (представника підвідділу Pezizomycotina, що входить до відділу Ascomycota). Як зразок для порівняння використовували амінокислотну послідовність поліаміноксідази дріжджів S. cerevisiae Fmslp [9]. Подібний підхід застосовували раніше при пошуку поліаміноксідаз серед фітопатогенних грибів [8]. Результати представлені на рис. 1.

    Показано, що поліаміноксідази і відповідні їм гени присутні у всіх досліджених видів з різних родин підвідділу Saccharomycotina. При цьому в залежності від систематичного положення кількість білків поліаміноксідаз і відповідних їм генів у досліджених видів різне: 1) основні представники сімейств Ascoideaceae, Phaffomycetaceae, Saccharomycetaceae містять тільки один ген, 2) представники сімейств Debaryomycetaceae, Met-schnikowiaceae і скарби Yarrowia - два гена, 3) представники сімейства Pichiaceae - 3 гена. Винятком для цього сімейства є дріжджі Komagataella phaffii (більше відомі під своєю старою назвою - Pichia pastoris), у яких виявлено два гена. Цей вид дріжджів є представником скарби Komagataella, яку в роботі [20] відносять до пара-Філетична сімейства Pichiaceae.

    Проведення філогенетичного аналізу з використанням послідовностей генів поліаміноксідаз виявилося утруднено великими відмінностями між нуклеотидними послідовностями виявлених генів. Тому проводили множинне порівняння амінокислотних послідовностей всіх поліамін-оксидаз, виявлених у досліджуваних видів дріжджів (рис. 2).

    Отримані результати дозволяють об'єднати амінокислотні послідовності поліаміноксі-даз в групи (ПАТ) на підставі їх подібності. Група ПАО1 об'єднує білки, виявлені у представників сімейств Ascoideaceae, Phaffomycetaceae, Saccharomycetaceae, у яких був виявлений тільки один ген поліаміноксідаз. Групи ПАО2.1 і ПАО2.2 об'єднують білки, виявлені у представників сімейства Metschnikowiaceae, у яких було виявлено два гена. ПАО3.1, ПАО3.2 і ПАО3.3 об'єднують білки, виявлені у представників сімейства Pichiaceae, у більшості з яких було виявлено

    Мал. 1. Поширеність поліаміноксідаз серед основних представників підвідділу Saccharomycotina. Филогенетические відносини показані, грунтуючись на результатах, отриманих в роботі [20]. Позначення ПГД відокремлює споріднені види, предки яких зазнали повногеномне дуплікацію [28]

    три гена. До цих груп (ПАО3.1 і ПАО3.2) відносяться також білки дріжджів Babjeviella inositovora (Debaryomycetaceae, два гена). Всередині самих груп ПАТ результати множинного порівняння послідовностей в цілому відображають филогенетические відносини у відповідних родинах підвідділу Saccharomycotina.

    2. Біоінформатіческій аналіз внутрішньоклітинної локалізації поліаміноксідаз

    Побічним продуктом реакцій, здійснюваних поліаміноксідазамі, є перекис водню, яка небезпечна для клітин. Тому у рослин і у тварин деякі поліаміноксідази направляються в пероксисоми [7]. Для всіх поліаміноксідаз був проведений пошук сигнальних послідовностей, які забезпечують їх транспорт в різні клітинні органели, в першу чергу в пероксисоми. Відомі два основних типи сигналів, що забезпечують

    транспорт білків в пероксисоми - PTS1 і PTS2 (Peroxisomal Targeting Signals). Найбільш поширеним є сигнал PTS1, який зустрічається більш ніж у 95% білків матриксу пероксисом. Початково сигнал PTS1 був визначений як послідовність з трьох амінокислот на С-кінці білка - SKL. Однак потім було показано, що цей сигнал може варіювати і вдає із себе Консу-Сусне послідовність [21]. Результати аналізу послідовностей поліаміноксідаз на наявність сигналів Пероксисомні локалізації представлені на рис. 2.

    Показано, що серед досліджених поліамінок-сідаз, виділяються групи ПАО2.2 і ПАО3.2, представники якої часто (в 6 випадках з 9) містять на С-кінці сигнал PTS1, відповідний консенсу-сної послідовності. При цьому у трьох білків послідовність на С-кінці не відповідає Консу-Сусне, але дуже близька до неї. послідовності

    32,6%

    43,4%

    99, 4%

    36,4%

    39,4%

    23,2%

    7D, 4%

    9S%

    36,2%

    37,6%

    97,6%

    74,2%

    13,4%

    99,4%

    99,4%

    32%

    B5,2%

    93, &%

    49,6%

    95,6%

    23,4%

    47,6%

    БВ, Б%

    56,2%

    33,3%

    69,2%

    33,4%

    Білок / вид

    PTS1

    сімейства

    XP 503341.1 Yarrowia lipolytica XP 501266.1 Yarrowia lipolytica AKL Скарбу Yarrowia

    XP_018713474.1 Metschnikowia sp. XP_001383524.2 Scheffersomyces stipitis XP_002546433.1 Candida tropicalis XP_716457.1 Candida albicans XP 018983323.1 Babjeviella inositovora - Debaryomycetaceae Metschnikowiaceae ПА02.1

    ПА03.1

    XP 022459189.1 Kuraishia capsulata XP_002493159.1 Komagataella phaffii XP_013933011.1 Ogataea parapolymorpha XP_019019768.1 Pichia membranifaciens XP 020546691.1 Pichia kudriavzevii XP_002494272.1 Komagataella phaffii XP_022459070.1 Kuraishia capsulata XP_013933434.1 Ogataea parapolymorpha XP_019016158.1 Pichia membranifaciens XP_020542396.1 Pichia kudriavzevii XP 022461193.1 Kuraishia capsulata XP_013933775.1 Ogataea parapolymorpha XP_019018091.1 Pichia membranifaciens XP_020543008.1 Pichia kudriavzevii SKL GKL AKF AKL Pichiaceae

    ПАОЗ.З

    ПА03.2

    XP_ 018986710.1 Babjeviella inositovora XP_018713421.1 Metschnikowia sp. XP_001387500.2 Scheffersomyces stipites XP 722661.1 Candida albicans XP_002545464.1 Candida tropicalis GRL SKI SKL SKL SKL Debaryomycetaceae Metschnikowiaceae

    ПА02.2

    XP_020047881.1 Ascoidea rubescens - Ascoideaceae ПА01

    XP 020072648.1 Cyberlindnerajadini - Phaffomycetaceae

    XP_002553058.1 Lachancea thermotolerans XP 002999399.1 Kluyveromyces lactis XP 449679.1 Candida glabrata XP 003679995.1 Toridaspora delbrueckii XP 002499197.1 Zygosaccharomyces rouxii XP_003954787.1 Kazachstania africana XP_018220082.1 Saccharomyces eubayanus XP 013733.1 Saccharomyces cerevisiae ERL Saccharomycetaceae

    XP_960607.2 Neurospora crassa - Sordariaceae

    Мал. 2. Результати множинного порівняння амінокислотних послідовностей поліаміноксідаз досліджуваних видів дріжджів. Показана представленість послідовностей PTS1, що забезпечують локалізацію білка в перок-сісомах, на С-кінці поліаміноксідаз досліджених видів дріжджів. Підкресленням виділені амінокислоти, відмінні від відомої для 5. cerevisiae консенсусної послідовності [22]

    поліаміноксідаз також були проаналізовані з використанням сервісу DeepLoc-1.0. Для передбачення локалізації білка в клітині дана програма використовує підхід, заснований не на пошуку відомих сигнальних послідовностей, а на машинному навчанні [22]. З використанням даного алгоритму в якості найбільш ймовірного варіанту локалізації поліаміноксідази дріжджів К. Сірка ^ І XP_002494272.1 (ген KpFMS2) були передбачені пероксисоми.

    Дріжджі К. Сірка ^ й, досліджувані в даній роботі, відносяться до метілотрофов, які здатні використовувати метиловий спирт в якості єдиного джерела вуглецю і енергії. Перші реакції шляху утилізації метанолу відбуваються в пероксисомах, що також пов'язано з утворенням перекису водню при окисленні метанолу до формальдегіду алкогольоксіда-зами [23]. Аналіз генома К. Сірка $ 11 показав, що у цього виду дріжджів ідентифіковані два незчеплених гена поліаміноксідаз KpFMS1 і KpFMS2. При цьому

    один з них (KpFMS2) розташований поруч з геном ал-когольоксідази 1 (AOX1). Гени KpFMS2 і AOX1 розташовуються «голова до голови» (head to head), і їх про-моторні області можуть перекриватися (рис. 3), що може впливати на регуляцію транскрипції KpFMS2.

    |II

    -843 -791

    -620 -573 -293 -257

    ген AOX1

    ген КрРМЕ2

    -1 -98 -150 -321 -368 -648 -684 -941

    ? - Сайти зв'язування білка Мхг1 | - Ділянки зв'язування білка Игд1

    ? - Матрична ланцюг

    Мал. 3. Взаємне розташування генів KpFMS2 і АОХ1 К. РНА // І. Показані сайти зв'язування транскрипційних факторів Mxг1p і Nгg1p, що є основними регуляторами промотора гена АОХ1

    3. Порівняльне вивчення експресії генів KpFMS1 і KpFMS2 у дріжджів К. phaffii

    Для дослідження регуляції активності промоторів генів поліаміноксідаз були отримані штами РРМ81-4-08115 і РРМ82-4-08115, які містять в своїх геномах послідовність репортерного гена кислої фосфатази РНО5 під контролем промоторів генів поліаміноксідаз. Для порівняння активності промоторів генів KpFMS2 і AOXl був також використаний отриманий раніше [14] штам 1x2-4-08115, що містить ген РНО5 під контролем промотора гена AOXl. Штами висували в серії розведень на тверді середовища з різними джерелами вуглецю і азоту. Як джерела вуглецю використовували гліцерин і метанол. Як джерела азоту використовували сульфат амонію. Окремо використовували повну середу YEPD, що містить глюкозу, дріжджовий екстракт і пептони. Результати якісного аналізу активності репортерного гена РНО5 у штамів РРМ81-4-08115, РРМ82-4-08115 і 1г2-4-08115 представлені на рис. 4.

    На середовищі YEPD, де в якості джерела вуглецю використовується глюкоза, а джерелом азоту є суміш амінокислот і олігопептидів, спостерігається активність промотора гена KpFMS2. У цих умовах активності промотора гена KpFMSl не було виявлено, а експресії гена АОХ1, як і слід було очікувати [24], не відбувається.

    На середовищах з гліцерином в якості джерела вуглецю промотори генів поліаміноксідаз неактивні. Експресія гена АОХ1 на таких середовищах була репресована гліцерином.

    На середовищі з метанолом як джерело вуглецю промотори генів KpFMS2 і АОХ1 активні. Активності промотора гена KpFMSl не було виявлено.

    ОБГОВОРЕННЯ

    Відомо, що дуплікації грають важливу роль в еволюції живих організмів. Дуплікації створюють додаткові копії генетичного матеріалу і вносять значний вклад у створення різноманітності геномів. Доля дупліціроваться генів може бути різною. Мутації можуть накопичуватися як у структурній, так

    середовища

    YEPD MGlyc MMet

    PFMS1-4-GS115

    и

    I PFMS2-4-GS115

    св

    ? ^ 2-4 ^ 115 (PAOX1-PHO5)

    Мал. 4. Активність репортерного кислої фосфатази штамів К. phaffii РРМ81-4-08115, РРМ82-4-08115 і 1г2-4-08115 при зростанні на середовищах з різними джерелами вуглецю і азоту

    і в регуляторній частинах. В результаті в ході еволюції з дупліціроваться генами можуть відбуватися такі процеси: 1) збереження, при якому дві копії гена зберігають функцію предкового гена, 2) неофунк-ціоналізація, при якій один з генів розвиває нову функцію, тоді як інший зберігає функцію предкового гена, 3) субфункціоналізація, в разі якої дві копії розвивають різні функції і працюють спільно для того, щоб компенсувати функцію предкового гена, і 4) спеціалізація, коли дві копії розвивають різні функції, і при цьому їх загальна функція також відрізняється від предковой функції (тобто тут об'єднуються процеси неофункціона-зації і субфункціоналізаціі) [25, 26]. Крім того, за рахунок зміни регуляторних областей структурні гени можуть ставати частиною інших регулона, відповідаючи на нові сигнали за рахунок взаємодії з новими регуляторними факторами.

    У даній роботі вперше проведено біоінфор-тичних аналіз поширеності поліамін-оксидаз серед основних представників підвідділу Saccharomycotina (відділ Ascomycota). Продемонстровано, що у всіх досліджуваних видів присутні поліаміноксідази і відповідні гени, проте їх копийность різна. Показано, що кількість копій корелює з систематичним положенням досліджуваних видів. Цікаво, що представники сімейства Saccharomycetaceae, до якого відносяться дріжджі S. cerevisiae, а також споріднених родин Ascoideaceae і Phaffomycetaceae мають тільки один ген поліаміноксідази. При цьому предки S. cerevisiae в ході еволюції зазнали повногеномне дуплікацію [27]. Таким чином, один з двох генів поліаміноксідаз, що утворилися в ході дуплікації у S. cerevisiae, в подальшому було втрачено, і даному виду дріжджів досить активності одного гена.

    У той же час у представників інших сімейств підвідділу Saccharomycotina збереглися два або навіть три гена поліаміноксідаз. Послідовності ці генів сильно дівергіровалі, а закодовані ними білки імовірно характеризуються різною внутрішньоклітинною локалізацією. У більшості проаналізованих видів, представників сімейств Debaryomycetaceae, Metschnikowiaceae, Pichiaceae і скарби Yarrowia, одна з поліаміноксідаз (групи ПАО2.2 і ПАО3.2) містить послідовність, направляючу її в пероксисоми. Білки дріжджів B. inositovora, Metschnikowia sp. і Ogataea parapolymorpha, пов'язаного із зазначеними групами поліаміноксідаз, несуть на С-кінці послідовності, які хоча і не відповідають консенсусної послідовності РТ81 S. cerevisiae, але дуже близькі до неї. Подальший аналіз їх локалізації може розширити набір відомих для дріжджів сигналів РТ81, напрямних білки в пероксисоми.

    Виявлені відмінності в представленості генів поліаміноксідаз можуть бути пов'язані з особливостями метаболізму різних видів дріжджів. В цьому відношенні особливо цікаво вивчення регуляції генів поліаміноксідаз у метилотрофних дріжджів K. phaffii. Ці дріжджі здатні використовувати метиловий спирт в якості єдиного джерела вуглецю і енергії. Алкогольоксидаза каталізує першу реакцію метаболізму метанолу. Цей фермент працює всередині пероксисом, оскільки його активність пов'язана з утворенням токсичного для клітини побічного продукту - перекису водню. Ген алкогольоксидази 1 строго регулюється джерелом вуглецю в середовищі. На середовищах з глюкозою і гліцерином спостерігається його репресія, а на середовищі з метанолом відбувається активація промотора даного гена [24]. Транскрипційний активатор Мхг1р є основним регулятором активності промотора гена АОХ1 [28].

    У представленій роботі показано, що один з двох генів поліаміноксідаз K. phaffii KpFMS2 розташований поруч з геном АОХ1 «голова до голови». Сайти зв'язування білка Mxr1 5'-CYCC-3 '[29] розподілені по всій області між кодують послідовностями генів KpFMS2 і АОХ1 і знаходяться на різних ланцюгах (див. Рис. 3). Білок Nrg1p забезпечує репресію гена АОХ1 у K. phaffii при наявності гліцерину і глюкози в середовищі [30]. Одна з областей, з якою взаємодіє Nrg1p, розташована поблизу кодує гена KpFMS2, друга - поблизу гена АОХ1 (див. Рис. 3). Таким чином, промоторні області даних генів можуть перекриватися, а самі вони мати схожі елементи регуляції.

    У даній роботі було вперше показано, що промотор гена KpFMS2 (перекривається з промотором гена АОХ1 і забезпечує транскрипцію в протилежному напрямку) функціонує на середовищах з метанолом. Рівень його активності був помітно менше, ніж у промотора гена АОХ1. Так само, як і промотор гена АОХ1, промотор гена KpFMS2 був неактивний на середовищах з гліцерином в якості джерела вуглецю. Але в той же час цей промотор був активний на середовищі YEPD. Тобто на відміну від промотора гена АОХ1, його робота не пригнічується глюкозою при зростанні K. phaffii на даному середовищі.

    Таким чином, ген KpFMS2 в результаті хромосомних перебудов виявився зчепленим з геном АОХ1. Даний ген зберігає свої особливості регуляції, але на середовищах з гліцерином і метанолом його промотор регулюється схоже з промотором гена АОХ1 та інших генів метаболізму метанолу, складових MUT-ре-Гулон. З одного боку, це може бути побічним ефектом надзвичайно високої активності промотора гена АОХ1. Відомо, що еукаріотичні промотори можуть забезпечувати транскрипцію довгих Некодуючі-

    щих РНК (long noncoding RNAs) [31]. З іншого боку, залучення гена KpFMS2 в MUT-регулон могло бути закріплено в ході еволюції. На користь цього припущення свідчить близькість групи поліамін-оксидаз ПАО3.3, куди відноситься білок, який кодується геном KpFMS2, групі ПАО3.2, куди входять білки, що несуть сигнали PTS1. І, хоча сам білок KpFms2 K. phaffii такій послідовності не містить, за допомогою сервісу DeepLoc-1.0 для нього передбачається локалізація в пероксисомах. Гени MUT-регулона активні при зростанні K. phaffii на середовищах з метанолом, коли в клітинах цих дріжджів спостерігається активна збірка і робота пероксисом. Залучення гена KpFMS2 в MUT-регулон, ймовірно, виявилося вигідно і було відібрано в ході еволюції.

    Активності промотора гена KpFMS1 в досліджених умовах не спостерігали. Це може бути наслідком того, що цей промотор або неактивний зовсім, або активується в специфічних умовах. Подальше вивчення функцій і регуляції експресії генів поліаміноксідаз у K. phaffii важливо як з теоретичної точки зору для розуміння еволюції дупліціроваться генів, так і з практичної, в зв'язку з величезною значимістю цих дріжджів і промоторів генів MUT-регулона для біотехнології.

    Подяки

    Робота виконана за підтримки гранту РФФД № 18-34-00750 мол_а.

    ЛІТЕРАТУРА

    1. Wallace HM, Fraser AV, Hughes A. A perspective of po-lyamine metabolism. Biochem J. 2003; 376 (Pt 1): 1 -14. https://doi.org/10.1042/BJ20031327.

    2. Miller-Fleming L, Olin-Sandoval V, Campbell K, Ralser M. Remaining mysteries of molecular biology: the role of polyamines in the cell. J Mol Biol. 2015; 427 (21): 3389-3406. https://doi.org/10.1016/j. jmb.2015.06.020.

    3. Wallace HM. Polyamines: specific metabolic regulators or multifunctional polycations? Biochem Soc Trans. 1998; 26 (4): 569-571. https://doi.org/10.1042/ bst0260569.

    4. White WH, Gunyuzlu PL, Toyn JH. Saccharomy-ces cerevisiae is capable of de novo pantothenic acid biosynthesis involving a novel pathway of beta-alanine production from spermine. J Biol Chem. 2001; 276 (14): 10794-10800. https://doi.org/10.1074/ jbc.M009804200.

    5. Chattopadhyay MK, Tabor CW, Tabor H. Spermidine but not spermine is essential for hypusine biosynthesis and growth in Saccharomyces cerevisiae: spermine is converted to spermidine in vivo by the FMS1-amine oxidase. Proc Natl Acad Sci USA. 2003; 100 (24): 13869-74. https://doi.org/10.1073/pnas.1835918100.

    6. Polticelli F, Salvi D, Mariottini P, et al. Molecular evolution of the polyamine oxidase gene family in Metazoa. BMC Evol Biol. 2012; 12:90. https: // doi. org / 10.1186 / 1471-2148-12-90.

    7. Reumann S, Ma C, Lemke S, Babujee L. AraPerox. A database of putative Arabidopsis proteins from plant peroxisomes. Plant Physiol. 2004; 136 (1): 2587-2608. https://doi.org/10.1104/pp.104.043695.

    8. Valdes-Santiago L, Cervantes-Chavez JA, Leon-Ramirez CG, Ruiz-Herrera J. Polyamine metabolism in fungi with emphasis on phytopathogenic species. J Amino Acids. 2012; 2012: 837932. https: // doi. org / 10.1155 / 2012/837932.

    9. Landry J, Sternglanz R. Yeast Fms1 is a FAD-utilizing polyamine oxidase. Biochem Biophys Res Commun. 2003; 303 (3): 771-776. https://doi.org/10.1016/ s0006-291x (03) 00416-9.

    10.Altschul SF, Gish W, Miller W, et al. Basic local alignment search tool. J Mol Biol. 1990; 215 (3): 403-410. https://doi.org/10.1016/S0022-2836(05) 80360-2.

    11.Kumar S, Stecher G, Li M, et al. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018; 35 (6): 1547-1549. https: // doi.org/10.1093/molbev/msy096.

    12. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994; 22 (22): 4673-4680. https: // doi.org/10.1093/nar/22.22.4673.

    13. Le SQ, Gascuel O. An improved general amino acid replacement matrix. Mol Biol Evol. 2008; 25 (7): 1307-20. https://doi.org/10.1093/molbev/msn067.

    14. Rumjantsev AM, Bondareva OV, Padkina MV, Sam-buk EV. Effect of nitrogen source and inorganic phosphate concentration on methanol utilization and PEX genes expression in Pichia pastoris. Scientific World Journal. 2014; 2014: 743615. https: // doi. org / 10.1155 / 2014/743615.

    15.Guthrie C, Fink GR. Guide to yeast genetics and molecular biology. Methods Enzymol. 1991; 194: 1-863. https://doi.org/10.1016/s0076-6879(00)x 0276-5.

    16.Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983; 166 (4): 557-580. https://doi.org/10.1016/s0022-2836(83)80284-8.

    17. Wu S, Letchworth GJ. High efficiency transformation by electroporation of Pichia pastoris pre-treated with lithium acetate and dithiothreitol. Biotechniques. 2004; 36 (1): 152-154. https: // doi. org / 10.2144 / 04361DD02.

    18. Остерман Л.А. Методи дослідження білків і нуклеїнових кислот. Електрофорез і ультрацентрифугирование (практичний посібник). - М .:

    Наука, 1981. - 288 с. [Osterman LA. Metody issle-dovaniya belkov i nukleinovykh kislot. Elektroforez i ul'tratsentrifugirovaniye (prakticheskoye posobiye). Moscow: Nauka; 1981. 288 p. (In Russ).]

    19. Самсонова М.Г., Падкіна М.В., Краснопевцева Н.Г. Генетико-біохімічне вивчення кислих фосфатаз дріжджів Saccharomyces cerevisiae // Генетика. -1975. - Т. 11. - № 9. - С. 104-115. [Samso-nova MG, Padkina MV, Krasnopevtseva NG. Ge-netiko-biokhimicheskoye izucheniye kislykh fosfataz drozhzhey Saccharomyces cerevisiae. Genetika. 1975; 11 (9): 104-115. (In Russ.)]

    20. Shen XX, Zhou X, Kominek J, et al. Reconstructing the backbone of the Saccharomycotina yeast phy-logeny using genome-scale data. G3 (Bethesda). 2016 року; 6 (12): 3927-3939. https://doi.org/10.1534/ g3.116.034744.

    21. Notzel C, Lingner T, Klingenberg H, Thoms S. Identification of new fungal peroxisomal matrix proteins and revision of the PTS1 consensus. Traffic. 2016 року; 17 (10): 1110-1124. https://doi.org/10.1111/tra.12426.

    22. Almagro Armenteros JJ, Sonderby CK, Sonderby SK, et al. DeepLoc: prediction of protein subcel-lular localization using deep learning. Bioinformatics. 2017; 33 (21): 3387-3395. https://doi.org/10.1093/bio-informatics/btx431.

    23. Ellis SB, Brust PF, Koutz PJ, et al. Isolation of alcohol oxidase and two other methanol regulatable genes from the yeast Pichia pastoris. Mol Cell Biol. 1985; 5 (5): 1111-21. https://doi.org/10.1128/mcb.5.5.1111.

    24. Tschopp JF, Brust PF, Cregg JM, et al. Expression of the lacZ gene from two methanol-regulated promoters in Pichia pastoris. Nucleic Acids Res. 1987; 15 (9): 3859-76. https://doi.org/10.1093/nar/15.9.3859.

    25. Assis R, Bachtrog D. Neofunctionalization of young duplicate genes in Drosophila. Proc Natl Acad Sci. 2013; 110 (43): 17409-17414. https://doi.org/10.1073/ pnas.1313759110.

    26. He X, Zhang J. Rapid subfunctionalization accompanied by prolonged and substantial neofunc-tionalization in duplicate gene evolution. Genetics. 2005; 169 (2): 1157-1164. https://doi.org/10.1534/ge-netics.104.037051.

    27.Kellis M, Birren BW, Lander ES. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature. 2004; 428 (6983): 617-624. https://doi.org/10.1038/ nature02424.

    28. Lin-Cereghino GP, Godfrey L, de la Cruz BJ, et al. Mxr1p, a key regulator of the methanol utilization pathway and peroxisomal genes in Pichia pastoris. Mol Cell Biol. 2006; 26 (3): 883-897. https: // doi. org / 10.1128 / MCB.26.3.883-897.2006.

    29. Kranthi BV, Kumar R, Kumar NV, et al. Identification of key DNA elements involved in promoter recognition

    by Mxrlp, a master regulator of methanol utilization pathway in Pichia pastoris. Biochim Biophys Acta. 2009 року; 1789 (6-8): 460-468. https://doi.org/l0.1016/j. bbagrm.2009.05.004.

    30. Wang X, Cai M, Shi L, et al. PpNrgl is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pasto-

    ris. Biotechnol Lett. 2016 року; 38 (2): 291-298. https: // doi. org / l0.1007 / s10529-015-1972-4.

    31. Wilkinson D, Vachova L, Hlavacek O, et al. Long noncoding RNAs in yeast cells and differentiated subpopulations of yeast colonies and biofilms. Oxid Med Cell Longev. 2018; 2018: 4950591. https: // doi. org / 10.1155 / 2018/4950591.

    * Інформація про авторів

    Аліна Владиславівна Іванова - студентка 4-го курсу кафедри генетики та біотехнології. ФГБОУ ВО «Санкт-Петербурзький державний університет», Санкт-Петербург. E-mail: alinalans @ gmail.com.

    Антон Віталійович Сидорин - бакалавр кафедри генетики та біотехнології. ФГБОУ ВО «Санкт-Петербурзький державний університет», Санкт-Петербург. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Олена Вікторівна Самбук - д-р біол. наук, професор кафедри генетики та біотехнології. ФГБОУ ВО «Санкт-Петербурзький державний університет», Санкт-Петербург. SPIN: 8281-8020. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Андрій Михайлович Румянцев - канд. біол. наук, молодший науковий співробітник кафедри генетики та біотехнології. ФГБОУ ВО «Санкт-Петербурзький державний університет», Санкт-Петербург. SPIN: 9335-1184. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    * Authors and affiliations

    Alina V. Ivanova - 4th year Student of the Department of Genetics and Biotechnology. Saint Petersburg State University, Saint Petersburg, Russia. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Anton V. Sidorin - Bachelor of Science (BSc) in the Genetics and Biotechnology Department. Saint Petersburg State University, Saint Petersburg, Russia. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Elena V. Sambuk - Doctor of Science, Professor of the Department of Genetics and Biotechnology. Saint Petersburg State University, Saint Petersburg, Russia. SPIN: 8281-8020. E-mail: e.sambuk @ spbu.org.ua.

    Andrei M. Rumyantsev - PhD, Senior Researcher of the Department of Genetics and Biotechnology. Saint Petersburg State University, Saint Petersburg, Russia. SPIN: 9335-1184. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..


    Ключові слова: ПОЛІАМІНОКСІДАЗИ / метилотрофних дріжджів / KOMAGATAELLA PHAFFII / PICHIA PASTORIS / POLYAMINE OXIDASES / METHYLOTROPHIC YEAST

    Завантажити оригінал статті:

    Завантажити