Законодавство Російської Федерації встановлює поріг вмісту генетично модифікованих організмів (ГМО) у харчових продуктах і кормах, після якого потрібно їх обов'язкове маркування, як 0,9%. У поточному аналізі найбільш поширеним способом виявлення ДНК ГМО є скринінг методом мультиплексной полімеразної ланцюгової реакції в реальному часі (ПЛР-РВ). У даній роботі нами показано, що обрана для аналізу комбінація стандартного набору мішеней 35S промотора вірусу мозаїки цвітної капусти (CaMV 35S) та термінатора NOS Agrobacterium tumefaciens є недостатньою для ефективного виявлення широкого спектра ліній ГМО. Нами були розроблені дві нові тест-системи, що забезпечують можливість виявлення ДНК 35S-промотора вірусу мозаїки норичника (P-

Анотація наукової статті з біотехнологій в медицині, автор наукової роботи - Алексєєв Яків Ігорович, Хотяїнцева Тетяна Володимирівна, Боровська Світлана Вікторівна, Колобова Ольга Сергіївна, Варламов Дмитро Олександрович


FMV) в якості додаткової мішені для скрінінга.org.uassian Federation regulations based on precautionary principle require any food containing more than 0.9% genetically modified organisms (GMO) to be specially labeled. In routine analysis, screening methods based on multiplex real-time PCR are most commonly used for the detection of GM plant material in food and feed. In this article, it is shown that the combination of two target sequences (CaMV 35S promoter and Agrobacterium tumefaciens NOS terminator) can not be used as a universal screening approach. Two GMO detection kits were designed, using 35S figwort mosaic virus promoter P-FMV as an additional target sequence.


Область наук:
  • Біотехнології в медицині
  • Рік видавництва: 2011
    Журнал: Вісті Тімірязевськой сільськогосподарської академії

    Наукова стаття на тему '35S промотор вірусу мозаїки норичника (p-fmv) - нова мішень для аналізу на вміст генетично модифікованих організмів '

    Текст наукової роботи на тему «35S промотор вірусу мозаїки норичника (p-fmv) - нова мішень для аналізу на вміст генетично модифікованих організмів»

    ?УДК 573.6

    35S промотор ВІРУСУ МОЗАИКИ норичника (P-FMV) - НОВА МІШЕНЬ ДЛЯ АНАЛІЗУ НА УТРИМАННЯ ГЕНЕТИЧНО МОДИФІКОВАНИХ ОРГАНІЗМІВ

    Я І. АЛЕКСЕЕВ12, Т.В. ХОТЯІНЦЕВА2, С.В. БОРОВСКАЯ12,

    О.С. КОЛОБОВА12, Д.А. ВАРЛАМОВ12, П.Н. ХАРЧЕНКО1

    (1 Всеросійський НДІ сільськогосподарської біотехнології Россельхозакадеміі;

    2 ЗАТ «Синтол»)

    Законодавство Російської Федерації встановлює поріг вмісту генетично модифікованих організмів (ГМО) у харчових продуктах і кормах, після якого потрібно їх обов'язкове маркування, як 0,9%. У поточному аналізі найбільш поширеним способом виявлення ДНК ГМО є скринінг методом мультиплексной полімеразної ланцюгової реакції в реальному часі (ПЛР-РВ). У даній роботі нами показано, що обрана для аналізу комбінація стандартного набору мішеней - 35S промотора вірусу мозаїки цвітної капусти (CaMV 35S) та термінатора NOS Agrobacterium tumefaciens - є недостатньою для ефективного виявлення широкого спектра ліній ГМО. Нами були розроблені дві нові тест-системи, що забезпечують можливість виявлення ДНК 35S-промотора вірусу мозаїки норичника (P-FMV) в якості додаткової мішені для скринінгу.

    Ключові слова: аналіз генетично модифікованих організмів, промотор вірусу мозаїки норичника, полімеразна ланцюгова реакція в реальному часі.

    Завдяки розвитку технологій генетичної інженерії в світі щорічно з'являються нові лінії генетично модифікованих організмів (ГМО). Обсяг вирощуваних трансгенних культур неухильно зростає, незважаючи на побоювання, викликані недостатньою вивченістю впливу ГМО на здоров'я людей і навколишнє природу. В даний час в багатьох країнах, в т.ч. в Росії, введене обов'язкове маркування харчової продукції, що гарантує споживачеві вибір між продукцією, що містить і не містить ГМО.

    Тест-системи для скринінгу ДНК ГМО-методом ПЛР-РВ, поширені на сьогоднішній день, виявляють ДНК стандартного набору мішеней - 358-промотора вірусу мозаїки цвітної капусти (CaMV 35S) та термінатора NOS Agrobacterium tumefaciens [1, 2]. Однак останнім часом в світі почали промислово вирощувати лінії ГМ-рослин, які містять цих регуляторних елементів. Для виявлення ДНК таких ГМ-рослин наявні тест-системи необхідно вдосконалити [6].

    Станом на 2011 р, в Росії дозволені до використання 17 ліній трансгенних рослин [7]. Регуляторні послідовності і гени трансгенних вставок цих ліній перераховані в таблиці.

    Як видно з таблиці, дві з дозволених ліній, а саме соя MON89788 і цукровий буряк H7-1, не містять ні промотора CaMV 35S, ні термінатора NOS, але містять промотор вірусу мозаїки норичника (P-FMV). Крім того, цей же промотор міститься в лініях ГМ-картоплі Луговський 1210 amk і Єлизавета 2904/1 kgs, а також в наступних промислово вирощуваних ГМО: ріпаку лінії

    Регуляторні послідовності і гени трансгенних вставок ліній, дозволених для застосування в харчових продуктах і кормах на території Російської Федерації

    Рослина Лінія Виробник Промотор Ген Термінатор

    GTS4032 Monsanto, США CaMV E35S CP4EPSPS NOS

    Соя A2704-12 Bayer CropScience, Німеччина CaMV 35S Pat CaMV 35S

    A5547-127 Bayer CropScience, Німеччина CaMV 35S Pat CaMV 35S

    MON89788 Monsanto, США P-FMV / TSF1 CP4EPEPS T-E9

    MON810 Monsanto, США CaMV E35S Cry1Ab -

    MON863 Monsanto, США 4AS1, CaMV E35S Cry3Bb1, nptII tahsp17, NOS

    NK603 Monsanto, США CaMV35S, ract CP4EPEPS NOS

    MON88017 Monsanto, США CaMV35S, ract CP4 EPEPS, Cry3Bb1 NOS, tahsp 17

    GA21 Monsanto, США ract mEPSPS NOS

    Кукурудза BT11 Syngenta Crop Protection AG, Швейцарія CaMV35S Cry1Ab, pat NOS

    MIR604 Syngenta Crop Protection AG, Швейцарія MTL ZmUbilnt mCry3A, mpi NOS

    T25 Bayer CropScience, Німеччина CaMV 35S pat CaMV 35S

    3272 Syngenta Seeds Inc, США GZein ZmUbiInt taa, mpi CaMV 35S, NOS

    Карто Луговський 1210 amk Центр біоінженерії РАН P-FMV Cry3A E9, NOS

    Фель Єлизавета 2904/1 kgs Центр біоінженерії РАН P-FMV Cry3A E9, NOS

    Рис LLRICE62 Bayer CropScience, Німеччина CaMV 35S bar CaMV 35S

    Цукрові буряки H7-1 Monsanto, США P-FMV CP4EPSPS rbcS E9

    GT73, картоплі лінії RBMT21-129, RBMT21-350, RBMT22-082; RBMT15-101, SEMT1502, SEMT1515, цукровому буряку лінії GTSB77; томаті лінії CGN-89322-3 (8338), кукурудзі лінії M0N89034; бавовні лінії MON-1445-2, MON88913.

    Вірус мозаїки норичника є каулімовіруси з групи параретровірусов і подібний до вірусу мозаїки цвітної капусти (cauliflower mosaic virus, CaMV). У 1989 р було проведено клонування послідовності Р-FMV-промотора, аналогічної послідовності 35S CaMV-промотора. Була підтверджена констатує-

    тивность промотора Р-FMV у всіх рослинних тканинах [1]. Було показано, що його сила дорівнює, а в деяких випадках перевищує таку промотора CaMV 35S і значно перевищує силу промотора NOS. Промотор P-FMV містить два енхансера, елімінація одного з яких знижує його активність на 75% [2]. Ефективність промотора була доведена в експериментах по трансформації тютюну, картоплі, сої, петунії, бавовни, рапсу, люцерни та інших рослин. В даний час промотор P-FMV є широко використовуваною альтернативою промотору CaMV 35S в генній інженерії с.-г. культур [3-5].

    матеріали та методи

    Так як регуляторні послідовності, використовувані в генній інженерії, часто піддаються модифікаціям, було проведено порівняння нуклеотидних послідовностей трансгенних ліній, що містять промотор P-FMV. Були підібрані праймери і зонд для ПЛР в реальному часі (ПЛР-РВ), специфічні загальному для ліній ріпаку GT73, кукурудзи MON89034 і сої MON89788 фрагменту ДНК-промотора (рис. 1).

    В якості матриці для проведення ПЛР-РВ аналізу була використана ДНК, виділена за допомогою набору «сорбіт-ГМО-Б» (ГНУ ВНІІСБ, Россельхозакадеміі) зі стандартного зразка, що містить більше 994,4 г / кг ГМ-сої лінії MON89788 виробництва компанії AOCS , США.

    результати

    На малюнку 2 показані результати ПЛР-РВ-аналізу серії 10-кратних розведень зразка цієї ДНК, виділеної з стандартного зразка ГМ-сої лінії MON89788.

    GT73 GGAACTCCCATCCTCAAAGGTTTGTAAGGAAGAATTCTCAGTCCAAAGCCTCAACAAGGT

    MON8 9034 GGAACTCCCATCCTCAAAGGTTTGTAAGGAAGAATTCTCAGTCCAAAGCCTCAACAAGGT

    MON8 97 8 8 ----------------- GCTCGAGTGGAAGCTAATTCTCAGTCCAAAGCCTCAACAAGGT

    ************************************* GT73 CAGGGTACAGAGTCTCCAAACCATTAGCCAAAAGCTACAGGAGATCAATGAAGAATCTTC

    MON8 9034 CAGGGTACAGAGTCTCCAAACCATTAGCCAAAAGCTACAGGAGATCAATGAAGAATCTTC

    MON8 97 8 8 CAGGGTACAGAGTCTCCAAACCATTAGCCAAAAGCTACAGGAGATCAATGAAGAATCTTC

    ************************************************** ********** GT73 AATCAAAGTAAACTACTGTTCCAGCACATGCATCATGGTCAGTAAGTTTCAGAAAAAGAC

    MON8 9034 AATCAAAGTAAACTACTGTTCCAGCACATGCATCATGGTCAGTAAGTTTCAGAAAAAGAC

    MON8 97 8 8 AATCAAAGTAAACTACTGTTCCAGCACATGCATCATGGTCAGTAAGTTTCAGAAAAAGAC

    ************************************************** ********** GT73 ATCCACCGAAGACTTAAAGTTAGTGGGCATCTTTGAAAGTAATCTTGTCAACATCGAGCA

    MON8 9034 ATCCACCGAAGACTTAAAGTTAGTGGGCATCTTTGAAAGTAATCTTGTCAACATCGAGCA

    MON8 97 8 8 ATCCACCGAAGACTTAAAGTTAGTGGGCATCTTTGAAAGTAATCTTGTCAACATCGAGCA

    ************************************************** ********** GT73 GCTGGCTTGTGGGGACCAGACAAAAAAGGAATGGTGCAGAATTGTTAGGCGCACCTACCA

    MON8 9034 GCTGGCTTGTGGGGACCAGACAAAAAAGGAATGGTGCAGAATTGTTAGGCGCACCTACCA

    MON8 97 8 8 GCTGGCTTGTGGGGACCAGACAAAAAAGGAATGGTGCAGAATTGTTAGGCGCACCTACCA

    ************************************************** **********

    GT73 AAAGCATCTTTGCCTTTATTGCAAAGATAAAGC---------------------------

    MON8 9034 AAAGCATCTTTGCCTTTATTGCAAAGATAAAGCAGATTCCTCTAGTACAAGTGGGGAACA

    MON8 97 8 8 AAAGCATCTTTGCCTTTATTGCAAAGATAAAGCAGATTCCTCTAGTACAAGTGGGGAACA

    Мал. 1. Послідовності фрагментів промотора P-FMV загальні для ліній ріпаку GT73,

    кукурудзи MON89034 і сої MON89788.

    Мал. 2. Кінетичні криві серії 10-кратних розведень ДНК ГМ-лінії сої МОИ89788, отримані на приладі для ПЛР-РВ АНК-З2 (ІАП ран, Санкт-Петербург)

    Специфічність підібраних праймерів і зонда була досліджена методом ПЛР-РВ на зразках ДНК, виділених з ГМ-ліній сої (А2704-12, А5547-35, 0Т84032, М0Ш9788), кукурудзи (Т25, БШ, М0Ш63, 1ЧК603, 0А21, М1Я604, М0К88017 , М0К810) і рису (ЬЬИСЕ62). Зростання сигналу флуоресценції спостерігалося тільки в реакції з зразком ДНК, виділеної з сої лінії М0К89788, що містить промотор Р-БМУ. Для всіх інших зразків зростання сигналу флуоресценції не спостерігалося, що підтверджує високу специфічність підібраних праймерів і зонда для ПЛР-РВ.

    Раніше нами були розроблені тест-системи «Рослина / 358 / К08 / ВПК» і «Соя / 358 / К08 / ВПК» для скринінгу ГМО методом мультиплексной ПЛР-РВ. Дані тест-системи дозволяють одночасно виявляти 4 різні ДНК-мішені в зразку. Для розширення спектру виявляються ГМО до наявних була додана реакція на п'яту мішень - ДНК-фрагмент промотору Р-БМУ. Необхідно було вивчити, чи позначиться введення цієї реакції на ефективність мультиплексной ПЛР-РВ. Для цього було проведено порівняння ефективності реакцій в мультиплексной ПЛР-РВ з додатковою реакцією детекції промотора Р-БМУ і без неї. Розраховані значення ефективностей реакцій по каналу детекції промотора Р-БМУ склали 99% в разі тетраплексной ПЛР-РВ і 98% в разі Пента-комплексної ПЛР-РВ. При цьому спостерігалося зменшення значень порогових циклів (ДО = 1) по цьому каналу.

    Отримані результати дозволили створити дві нові тест-системи для розширеного скринінгу ГМО. В обох тест-системах по каналу Я0Х проводиться одночасна детекція двох мішеней: фрагментів ДНК саму 358-промотора і Р-БМУ-промотора. Крім того, в тест-системі «Рослина / 358 + РМУЖ08-ВПК» по каналу

    FAM детектується наявність в аналізованому зразку ДНК-термінатора NOS, по каналу RoG-фрагмента гена NADH-дегідрогенази (референсна реакція для визначення вмісту рослинної ДНК в зразку), по каналу Cy5 - реакція внутрішнього позитивного контролю (ВПК), що дозволяє уникнути помилково негативні результати аналізу. Аналогічний склад має тест-система «Соя / 35S + FMV / NOS-ВПК», за винятком того, що по каналу R6G детектується наявність в зразку ДНК-фрагмента гена лектина сої.

    На малюнку 3 наведено приклад роботи тест-системи «C ^ 35S + FMV / NOS-BnK» на серії 10-кратних розведень суміші ДНК сої лінії MON89788 і сої лінії GTS4032 по 4 каналам детекції. Для аналізу кінетичних кривих ПЛР застосовували апроксимацію рекурсивними функціями [8], що дозволяє підвищити точність кількісного аналізу. Залежність значення порогового циклу від логарифма концентрації добре описується лінійною функцією, при цьому розрахований за допомогою методу найменших квадратів коефіцієнт кореляції R2 склав 0,9998. Межа детекції тест-систем становить 10 копій ДНК мішені в реакційній суміші, що відповідає менш ніж 0,01% вмісту ДНК ГМО в зразку.

    Мал. 3. Результат ПЛР-РВ-аналізу серії 10-кратних розведень суміші ДНК сої лінії MON89788 і сої лінії GTS4032 за допомогою тест-системи «Соя / 35S + FMV / NOS-ВПК»

    Розроблені тест-системи «PacreHHe / 35S + FMV / NOS-BnK» і «Соя / 358 + FMV / NOS-ВПК» дозволяють виявляти все лінії ГМО, дозволені для застосування в харчових продуктах і кормах в Росії, а також істотно розширюють спектр виявляються ліній ГМО, заборонених до використання на її території, але промислово вирощуваних в світі.

    Робота виконана за фінансової підтримки Міністерства освіти і науки Російської Федерації в рамках виконання ФЦП «Дослідження і розробки по пріоритетним напрямком розвитку науково-технологічного комплексу Росії на 2007-2012 роки» ГК № 16.552.11.7032 від 29 квітня 2011 року на обладнанні ЦКП «ВНІІСБ ».

    бібліографічний список

    1. Bahrdt C., Krech A.B., Wurz A., Wulff D. // J Biotechnol., 2011. Mar 10; 152 (1-2): 58-62.

    2. Dorries H.H., Remus I., Gronewald A., Gronewald C., Berghof-Jager K. // Anal. Bioanal Chem., 2010. Mar; 396 (6): 2043-54.

    3. Ranjan R., Patro S., Kumari S., Kumar D., Dey N., Maiti I.B. // Anal. Bioanal. Chem., 2010. Mar .; 396 (6): 2103-12.

    4. Samac D.A., Tesfaye M., Dornbusch M., Saruul P., Temple S.J. Transgenic Res., 2004. Aug; 13 (4): 349-61.

    5. Sanger M., Daubert S., Goodman R.M. // Plant Mol. Biol., 1990. 14: 433 443.

    6. Waiblinger H.-U., Grohmann L., Mankertz J., Engelbert D., Pietsch K. // Anal. Bioanal Chem., 2010. 396: 2065-2072.

    7. http://fp.crc.org.ua/gosregfr/ Реєстр продукції, яка пройшла державну реєстрацію (видані Федеральною службою, включаючи Управління).

    8. Сочівко Д.Г., Федоров А.А., Лавров В.В., Варламов Д.А., Курочкін В.Є., Петров Р.В. ДАН, 2011. 439 (5): 696-699.

    Рецензент - д. Б. н. Г.І. Карлов

    SUMMARY

    Russian Federation regulations based on precautionary principle require any food containing more than 0.9% genetically modified organisms (GMO) to be specially labeled. In routine analysis, screening methods based on multiplex real-time PCR are most commonly used for the detection of GM plant material in food and feed. In this article, it is shown that the combination of two target sequences (CaMV 35S promoter and Agrobacterium tumefaciens NOS terminator) can not be used as a universal screening approach. Two GMO detection kits were designed, using 35S figwort mosaic virus promoter P-FMV as an additional target sequence.

    Key words: genetically modified organisms detection, figwort mosaic virus promoter, real time polymerase chain reaction.

    Алексєєв Яків Ігорович - зав. лабораторією аналізу ГМО ВНІІСБ, керівник ЦКП ВНІІСБ, науковий директор ЗАТ «Синтол». Тел. (499) 977-74-55.

    Ел. пошта: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Хотяїнцева Тетяна Володимирівна - науковий співробітник ЗАТ «Синтол».

    Ел. пошта: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її..

    Боровська Світлана Вікторівна - науковий співробітник ВНІІСБ, науковий співробітник ЗАТ «Синтол».

    Колобова Ольга Сергіївна - старший науковий співробітник ВНІІСБ, науковий співробітник ЗАТ «Синтол».

    Варламов Дмитро Олександрович - старший науковий співробітник ВНІІСБ, провідний науковий співробітник ЗАТ «Синтол».

    Харченко Петро Миколайович - чл.-кор. Россельхозакадеміі, д.б.н., професор, директор вНіісб.


    Ключові слова: АНАЛІЗ ГЕНЕТИЧНО МОДИФІКОВАНИХ ОРГАНІЗМІВ / Промотор ВІРУСУ МОЗАИКИ норичника / Полімеразна ланцюгова реакція в реальному часі / GENETICALLY MODIFIED ORGANISMS DETECTION / FIGWORT MOSAIC VIRUS PROMOTER / REAL TIME POLYMERASE CHAIN ​​REACTION

    Завантажити оригінал статті:

    Завантажити