Мета. 11-амінокислотний пептид, що імітує природну структуру? -Спіралі B еритропоетину (P-? B) Має специфічний спорідненістю до гетеродімерному комплексу EPOR / CD131. У нашому дослідженні ми вирішили перевірити чи може P-? B позиціонуватися як засіб для профілактики і лікування серцево-судинних заболеваній.Матеріали і методи. Дослідження виконано на статевозрілих самцях щурів лінії Wistar. дисфункцію ендотелію моделювали шляхом 7-денного внутрішньочеревно введення L-NAME в дозі 2,5 мг / 100 г. У якості терапії використовували P-? B або еритропоетин (EPO) в дозі 2,5 мкг / 100 г? 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г. Функцію ендотелію оцінювали шляхом проведення ендотелійзалежної і ендотелійнезавісімой вазодилатації. На додаток до цього проводили гістологічну оцінку стану стінки абдомінальної аорти і аналіз експресії генів eNos, Tnf і Il-1 ?. Для оцінки протромботичних властивостей P-? B і EPO вводили в дозах 2,5 і 5 мкг / 100 г (3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г і 15 мкг / 100 г, відповідно) і на 8-й день оцінювали час заліза ( III) хлорид-індукованого тромбозу сонної артеріі.Результати. P-? B і EPO не впливають на L-NAME-індуковану гіпертензію, проте покращують функцію ендотелію, про що свідчать результати функціональних проб на ендотелійзалежну і ендотелійнезавісімую вазодилатацию, а також гістологічна картина аорти. При цьому P-? B демонструє значно більшу ендотеліопротектівную активність, знижуючи коефіцієнт ендотеліальної дисфункції з 5,1 ± 0,15 до 2,72 ± 0,12. Крім того, P-? B значно збільшив експресію eNos, і знизив рівень експресії мРНК генів Tnf і Il-1 ?. При проведенні заліза (III) хлорид-індукованого тромбозу сонної артерії виявлено, що P-? B (В дозі 5 мкг / 100 г? 3 рази протягом 7 днів, сумарна доза 15 мкг / 100 г) має меншу, ніж EPO, але статистично значущою протромботичні актівностью.Заключеніе. P-? B може позиціонуватися як атеропротектора через здатність запобігати загибель ендотеліоцитів, а також знижувати ремоделювання і прозапальну активацію судинної стінки. Проте протромботичні властивості P-? B обмежують його застосування в якості засобу для профілактики і лікування атеросклерозу-асоційованих захворювань.

Анотація наукової статті з фундаментальної медицини, автор наукової роботи - Корокін М.В., Солдатов В.О., Титце А., Голубєв І.В., Білих А.Є..


11-amino acid peptide imitating the structure of erythropoietin? -Helix b improves endothelial function, but stimulates thrombosis in rats

The aim of the study was to test whether P-? B can be positioned as a preventing and treating agent for cardiovascular diseases.Materials and methods. The study was performed on sexually mature male Wistar rats. Endothelial dysfunction was modulated by a 7-days intraperitoneal administration of L-NAME at the dose of 2.5 mg / 100 g. P-? B, or erythropoietin (EPO), was used for therapy at the dose of 2.5 μg / 100 g? 3 times for 7 days, the total dose was 7.5 μg / 100 g. The function of endothelium was estimated by an endothelium-dependent and endothelium-independent vasodilation. In addition, a histological assessment of the abdominal aortic wall state and the analysis of eNos, Tnf and Il-1? genes expression were performed. To estimate prothrombotic properties, P-? B and EPO were administered, at the doses of 2.5 and 5 μg / 100 g (3 times a day for 7 days, the total doses were 7.5 μg / 100 g and 15 μg / 100 g, respectively) and on the 8th day, the time of ferric (III) chloride-induced carotid artery thrombosis was estimated.Results. Theresults of the functional tests for endothelium-dependent and endothelium-independent vasodilatation, as well as the histological picture of the aorta have evidenced that P-? B and EPO do not affect L-NAME-induced hypertension but improve the endothelium function. At the same time, P-? B shows a significantly higher endothelial-protective activity, reducing the coefficient of endothelial dysfunction from 5.1 ± 0.15 to 2.72 ± 0.12. In addition, P-? B has significantly increased the expression of eNos and reduced the expression level of Tnf and Il-1? mRNA genes. Carrying out Ferric (III) chloride-induced carotid artery thrombosis has revealed that P-? B (5 μg / 100 g? 3 times a day for 7 days, total dose was 15 μg / 100 g) has a lower but statistically significant prothrombotic activity than EPO.Conclusion. P-? B can be positioned as an atheroprotector because of its ability to prevent the death of endothelial cells, as well as to reduce remodeling and proinflammatory activation of the vascular wall. However, the prothrombotic properties of P-? B limit its use as a preventing and treating agent for atherosclerosis-associated diseases.


Область наук:
  • фундаментальна медицина
  • Рік видавництва: 2019
    Журнал: Фармація і фармакологія

    Наукова стаття на тему '11 -АМІНОКІСЛОТНИЙ ПЕПТИД, що імітують структуру A-СПІРАЛІ B еритропоетин, ПОЛІПШУЄ ФУНКЦІЮ ЕНДОТЕЛІЮ, АЛЕ СТИМУЛЮЄ тромбоутворення У ЩУРІВ '

    Текст наукової роботи на тему «11-АМІНОКИСЛОТНИЙ ПЕПТИД, що імітують структуру A-СПІРАЛІ B еритропоетин, ПОЛІПШУЄ ФУНКЦІЮ ЕНДОТЕЛІЮ, АЛЕ СТИМУЛЮЄ тромбоутворення У ЩУРІВ»

    ?ISSN 2307-9266 e-ISSN 2413-2241

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    УДК: 615.225

    11-АМІНОКИСЛОТНИЙ ПЕПТИД, що імітують структуру A-СПІРАЛІ B еритропоетин, ПОЛІПШУЄ ФУНКЦІЮ ЕНДОТЕЛІЮ, АЛЕ СТИМУЛЮЄ тромбоутворення У ЩУРІВ

    М.В. Корокін1, В.О. Солдатов1, А. Тітце2, І.В. Голубев1, А.Е. Белих3, М.В. Кубекіна4, О.А. Пученкова1, Т.А. Денісюк3, В.В. Гуреев1, Т.Г. Покровская1, О.С. Гудирев1, М.А. Жученко5, М.А. Затолокіна3, М.В. Покровскій1

    1 ФГАОУ ВО «Бєлгородський державний університет» 308015, Росія, м Білгород, вул. Перемоги, 85

    2 Гетеборзький університет, факультет хімії і молекулярної біології, відділ органічної та медичної хімії

    41271, Швеція. Гетеборг, вул. Медицини Арегатан, 9C

    3 ФГБОУ ВО «Курський державний медичний університет» 305041, Росія, м Курськ, вул. Карла Маркса, 3

    4 ФГБУН «Інститут біології гена РАН» 119334, Россия, г. Москва, вул. Вавилова, 34/5

    5 НДЦ «Курчатовський інститут» - ДержНДІгенетика 123098, Россия, г. Москва, пл. Академіка Курчатова, 1

    Мета. 11-амінокислотний пептид, що імітує природну структуру а-спіралі B еритропоетину (P-aB) має специфічний спорідненістю до гетеродімерному комплексу EPOR / CD131. У нашому дослідженні ми вирішили перевірити чи може P-aB позиціонуватися як засіб для профілактики і лікування серцево-судинних захворювань.

    Матеріали та методи. Дослідження виконано на статевозрілих самцях щурів лінії Wistar. Дисфункцію ендотелію моделювали шляхом 7-денного внутрішньочеревно введення L-NAME в дозі 2,5 мг / 100 г. У якості терапії використовували P-aB або ерітропо-Етін (EPO) в дозі 2,5 мкг / 100 г х 3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г. Функцію ендотелію оцінювали шляхом проведення ендотелійзалежної і ендотелійнезавісімой вазодилатації. На додаток до цього проводили гістологічну оцінку стану стінки абдомінальної аорти і аналіз експресії генів eNos, Tnf і Il-1 ?. Для оцінки протромботичних властивостей P-aB і EPO вводили в дозах 2,5 і 5 мкг / 100 г (3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г і 15 мкг / 100 г, відповідно) і на 8 -й день оцінювали час заліза (III) хлорид-індукованого тромбозу сонної артерії.

    Результати. P-aB і EPO не впливають на L-NAME-індуковану гіпертензію, проте покращують функцію ендотелію, про що свідчать результати функціональних проб на ендотелійзалежну і ендотелійнезавісімую вазодилатацию, а також гістологічна картина аорти. При цьому P-aB демонструє значно більшу ендотеліопротектівную активність, знижуючи коефіцієнт ендоте-ліальной дисфункції з 5,1 ± 0,15 до 2,72 ± 0,12. Крім того, P-aB значно збільшив експресію eNos, і знизив рівень експресії мРНК генів Tnf і Il-1 ?. При проведенні заліза (III) хлорид-індукованого тромбозу сонної артерії виявлено, що P-aB (в дозі 5 мкг / 100 г х 3 рази протягом 7 днів, сумарна доза 15 мкг / 100 г) має меншу, ніж EPO, але статистично значущою протріть-ботіческой активністю.

    Висновок. P-aB може позиціонуватися як атеропротектора через здатність запобігати загибель ендотеліоцитів, а також знижувати ремоделювання і прозапальну активацію судинної стінки. Проте протромботичні властивості P-aB обмежують його застосування в якості засобу для профілактики і лікування атеросклерозу-асоційованих захворювань. Ключові слова: атеросклероз, еритропоетин, щури, P-aB, цібенітід, ендотелій

    Список скорочень: P-aB - a-спіраль B еритропоетину; EPO - еритропоетин; L-NAME - N-нітро ^ -аргінін метиловий ефір; eNOS - ендотеліальна синтаза оксиду азоту; ЕД - ендотеліальна дисфункція; КЕД - коефіцієнт ендотеліальної дисфункції; САД -сістоліческое артеріальний тиск; ДАТ - діастолічний артеріальний тиск.

    Для цитування: М.В. Корокін, В.О. Солдатов, А. Титце, І.В. Голубєв, А.Е. Білих, М.В. Кубекіна, О.А. Пученкова, Т.А. Денисюк, В.В.

    Гуреєв, Т.Г. Покровська, О.С. Гудир, М.А. Жученко, М.А. Затолокіна, М.В. Покровський. 11-амінокислотний пептид, що імітує структуру а-спіралі b еритропоетину, покращує функцію ендотелію, але стимулює тромбоутворення у щурів. Фармація і фармакологія. 2019; 7 (6): 312-320. DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    © М.В. Корокін, В.О. Солдатов, А. Титце, І.В. Голубєв, А.Е. Білих, М.В. Кубекіна, О.А. Пученкова, Т.А. Денисюк, В.В. Гуреєв,

    Т.Г. Покровська, О.С. Гудир, М.А. Жученко, М.А. Затолокіна, М.В. Покровський, 2019

    For citation: M.V. Korokin, V.O. Soldatov, A.A. Tietze, I.V Golubev, A.E. Belykh, M.V Kubekina, O.A. Puchenkova, T.A. Denisyuk, V.V Gureyev, T.G. Pokrovskaya, O.S. Gudyrev, M.A. Zhuchenko, M.A. Zatolokina, M.V Pokrovskiy. 11-amino acid peptide imitating the structure of erythropoietin a-helix b improves endothelial function, but stimulates thrombosis in rats. Pharmacy & Pharmacology. 2019; 7 (6): 312-320. DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    отримано 06.12.2019

    Рецензія (1) 20.12.2019

    Рецензія (2) 26.12.2019 Прийнята до друку 27.12.2019

    Scientific and Practical Journal

    PHARMACY & PHARMACOLOGY

    RESEARCH ARTICLE

    DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    11-AMINO ACID PEPTIDE IMITATING THE STRUCTURE OF ERYTHROPOIETIN A-HELIX B IMPROVES ENDOTHELIAL FUNCTION, BUT STIMULATES THROMBOSIS IN RATS

    M.V. Korokin1, V.O. Soldatov1, A.A. Tietze2, I.V. Golubev1, A.E. Belykh3, M.V. Kubekina4,

    O.A. Puchenkova1, T.A. Denisyuk3, V.V. Gureyev1, T.G. Pokrovskaya1, O.S. Gudyrev1, M.A. Zhuchenko5,

    M.A. Zatolokina3, M.V. Pokrovskiy1

    1 Belgorod State National Research University 85, Pobeda St., Belgorod, Russia 308015

    2 University of Gothenburg, Department of Chemistry and Molecular Biology, Department of Organic and Medicinal Chemistry.

    PO Box 462 9 C, Medicine Aregatan St., Goteborg, Sweden

    3 Kursk State Medical University

    3, Karl Marx St., Kursk, Russia 305041

    4 Institute of Gene Biology of the Russian Academy of Sciences 34/5, Vavilov St., Moscow, Russia 119334

    5 Scientific Research Centre, Kurchatov Institute

    1, Akademik Kurchatov Square, Moscow, Russia 123098

    E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Received 6 December 2019 Review (1) 20 December 2019 Review (2) 26 December 2019 Accepted 27 December 2019

    An 11-amino acid peptide imitating the natural structure of B erythropoietin a-helix (P-aB), has a specific affinity to the heterodimeric complex EPOR / CD131.

    The aim of the study was to test whether P-aB can be positioned as a preventing and treating agent for cardiovascular diseases. Materials and methods. The study was performed on sexually mature male Wistar rats. Endothelial dysfunction was modulated by a 7-days intraperitoneal administration of L-NAME at the dose of 2.5 mg / 100 g. P-aB, or erythropoietin (EPO), was used for therapy at the dose of 2.5 ^ g / 100 g x 3 times for 7 days, the total dose was 7.5 ^ g / 100 g. The function of endothelium was estimated by an endothelium-dependent and endothelium-independent vasodilation. In addition, a histological assessment of the abdominal aortic wall state and the analysis of eNos, Tnf and II-18 genes expression were performed. To estimate prothrombotic properties, P-aB and EPO were administered, at the doses of 2.5 and 5 ^ g / 100 g (3 times a day for 7 days, the total doses were 7.5 ^ g / 100 g and 15 ^ g / 100 g, respectively) and on the 8th day, the time of ferric (III) chloride-induced carotid artery thrombosis was estimated.

    Results. The results of the functional tests for endothelium-dependent and endothelium-independent vasodilatation, as well as the histological picture of the aorta have evidenced that P-aB and EPO do not affect L-NAME-induced hypertension but improve the endothelium function. At the same time, P-aB shows a significantly higher endothelial-protective activity, reducing the coefficient of endothelial dysfunction from 5.1 ± 0.15 to 2.72 ± 0.12. In addition, P-aB has significantly increased the expression of eNos and reduced the expression level of Tnf and II-18 mRNA genes. Carrying out Ferric (III) chloride-induced carotid artery thrombosis has revealed that P-aB (5 ^ g / 100 gx 3 times a day for 7 days, total dose was 15 ^ g / 100 g) has a lower but statistically significant prothrombotic activity than EPO.

    Conclusion. P-aB can be positioned as an atheroprotector because of its ability to prevent the death of endothelial cells, as well as to reduce remodeling and proinflammatory activation of the vascular wall. However, the prothrombotic properties of P-aB limit its use as a preventing and treating agent for atherosclerosis-associated diseases. Keywords: atherosclerosis, erythropoietin, rats, P-aB, cibenitide, endothelium

    Abbreviations: P-aB - a-helix of B erythropoietin; EPO - erythropoietin; L-NAME - N (w) -nitro-L-arginine methyl ester; eNOS - endothelial nitric oxide synthase; ED - endothelial dysfunction; EDC - endothelial dysfunction coefficient; SBP - systolic blood pressure; DBP - diastolic blood pressure.

    ВСТУП

    Перманентне зростання атеросклероз-асоціації-рова захворювань в загальній структурі причин смертності та інвалідизації населення розвинених країн диктує необхідність їх поглибленого вивчення і вдосконалення методів корекції [1, 2]. При цьому досвід, накопичений, починаючи з перших робіт М.М. Анічкова [3], демонструє, що атеро-склеротическое пошкодження судинної стінки є тривалим багатофакторним процесом [4]. Відповідно до сучасним розумінням патогенезу серцево-судинних захворювань, інтеграли-

    ву роль в розвитку атеросклерозу і пов'язаних з ним ускладнень грає ендотеліальна дисфункція (ЕД) [5-7]. Зміни в спектрі секретується і експрессіруемих ендотелієм молекул і порушення його бар'єрної функції в кінцевому підсумку призводять до інфільтрації судинної стінки атероматозні-ми масами і утворенню атеросклеротичних бляшок [8]. Виникає патогенетичний каскад стає актуальною мішенню для фармакологічного впливу [1, 2].

    Ефективним способом запобігти пошкодженню ендотелію є застосування молекул

    ISSN 2307-9266 e-ISSN 2413-2241

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    з універсальною цитопротекторної активністю [9]. Однією з таких молекул є ендогенний Глік-протеїн еритропоетин (EPO) [10]. Ряд проведених нами робіт продемонстрував, що EPO здатний значно покращувати морфофункціональний стан судинної стінки при моделюванні ЕД у щурів [11-14]. Проте, багаторічний досвід показує, що багатообіцяючі результати доклінічних досліджень EPO слабо транслюються в клінічну реальність і його головною нішею залишається лікування анемії [15-17].

    У 2004 р Michael Brines і ін. [17] довели, що негематопоетіческіе ефекти EPO реалізуються через гетеродімерний комплекс EPOR / CD131. Виявлення того факту, що ерітропоетіческой і ткане-захисні властивості EPO реалізуються за допомогою двох різних рецепторних систем, привело до створення передумов для принципово нового напрямку в пошуку інноваційних молекул з ци-топротекторной активністю. У 2008 р ті ж автори [18] представили узагальнені результати вивчення цитопротекторних активності 11-амінокислотно-го пептиду на основі а-спіралі B еритропоетину, що імітує просторову частину молекули, яка взаємодіє з гетеродімерним EPOR / CD131 рецептором, але не взаємодіє з гомоді- мірним EPOR / EPOR рецептором. Дане з'єднання (P-aB, цібенітід, PubChem CID: 91810664) продемонстрував здатність істотно покращувати морфофункціональний стан тканин при діабетичному набряку сітківки, ішемії-реперфузії нирок, а також значно покращувати когнітивні функції в моделі галантамин-індукованої амнезії, при відсутності будь-якого впливу на еритропоез.

    МЕТА ДОСЛІДЖЕННЯ - оцінка ендотеліопро-тектівной і атеропротектівний активності P-aB, а також оцінка протромботичних властивостей даної молекули для виявлення перешкод в клінічному застосуванні P-aB як засіб для лікування і профілактики серцево-судинних катастроф.

    МАТЕРІАЛИ ТА МЕТОДИ

    тварини

    Тварини були отримані з розплідника Charles River Laboratories (Массачусетс, США). Містилися в центрі доклінічних досліджень НДІ Фармакології живих систем. Після проходження 14-денного карантинного режиму, щури були стратифіковані за масою і розсаджені по 9 особин в окремі конвенційні клітини відповідно до приналежністю до експериментальної групі. До і під час виконання дослідження тварини містилися в приміщеннях з штучним освітленням (режим 12 год / 12 год) при температурі 21-23 ° С, вологості 38-50% і мали вільний доступ до корму і воді. Номер висновку незалежного етичного комітету 06-09 / 02-1 від 16.05.2019 р.

    Експеримент був виконаний на 76 щурах-самцях (200-220 г) лінії Wistar. При роботі дотримувалися вимоги Закону РФ «Про захист тварин від жорстокого поводження» від 24.06.1998 року, правил лабораторної практики при проведенні доклінічних досліджень в РФ (ГОСТ 3 51000.3-96 і ГОСТ Р 53434-2009), директиви Європейського співтовариства (86/609 ЄС) і Правил лабораторної практики, прийнятих в Російській Федерації (наказ МОЗ РФ № 708 від 29.08.2010 р).

    Моделювання ендотеліальної дисфункції

    Дисфункцію ендотелію моделювали шляхом 7-денного внутрішньочеревно введення блокато-ра ендотеліальної синтази оксиду азоту L-NAME (Sigma Aldrich, США) в дозі 2,5 мг / 100 г. Для оцінки ендотеліопротектівного ефекту P-aB в порівнянні з EPO з 36 щурів самців лінії Wistаr (200-220 г) були сформовані 4 групи по 9 тварин:

    1) ЕД + EPO (ТОВ «Фармапарк») (2,5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г);

    2) ЕД + P-aB (ТОВ «Фармапарк») (2,5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г);

    3) ЕД + Розчинник (0,9% розчин натрію хлориду 0,1 мл / 100 г 3 рази на добу протягом 7 днів, сумарна доза 0,3 мл / 100 г);

    4) Інтактні + Розчинник (0,9% розчин натрію хлориду 0,1 мл / 100 г 3 рази на добу протягом 7 днів, сумарна доза 0,3 мл / 100 г).

    Рівно через 24 години після останнього введення L-NAME кожній тварині під наркозом (Зола-зепам (Vi ^ c, Франція) 6 мг / 100 г + Хлоралгідрат (Рапгеас, Іспанія)) катетерізіровать ліву сонну артерію для внутрішньосудинного вимірювання артеріального тиску за допомогою апарату Вюрас MP150. На тлі безперервного вимірювання артеріального тиску стимулювали ендотелійзалежну (Ацетилхолин 4 мкг / 100 г) і ендотелійнезавісімую (Натрію нітропрусид, 3 мкг / 100 г) вазодилатацию. Вазоактивні агенти вводили з інтервалом 15 хвилин через катетер, встановлений в стегнової вені. При виконанні всіх маніпуляцій тваринам було присвоєно унікальний код і хірург не знав приналежність тварини до групі. Відношення площі над кривою падіння тиску при введенні натрію нітропрусиду до площі над кривою падіння тиску при введенні ацетилхоліну брали за коефіцієнт ендотеліальної дисфункції (КЕД).

    Після проведення функціональних судинних проб тварин евтаназіровалі знекровленням і забирали абдомінальний відділ аорти для гістологічних досліджень, а також оцінки експресії мРНК генів eNos, Il-1b і Tnf.

    Гістологія

    Зразки абдомінальної аорти фіксували в 10% -розчину формальдегіду з подальшою затоку-

    PHARMACY & DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    PHARMACOLOGY

    кой в ​​парафін в автоматі карусельного типу «STP-120» (Microm International GMbH, Німеччина). Заливку блоків зі стандартною орієнтацією шматочків здійснювали на станції для заливки біологічного матеріалу в парафін «EC 350» (Microm International GMBH, Німеччина). Для забезпечення стандартизації заливку в парафін здійснювали у вигляді мультіб-локов по 5-6 шматочків. Зрізи для гістологічного дослідження товщиною 5 мкм виготовляли на напівавтоматичному ротаційному мікротому з системою транспортування та расправления зрізів «НМ 340Е» (Microm International GMbH, Німеччина). Забарвлення гематоксиліном і еозином здійснювали в автоматі для забарвлення гістологічних зрізів і мазків (Microm International GMbH, Німеччина). Описову дослідження гістологічних препаратів виконували під мікроскопом Axio Scope A1 (Carl Zeiss Microimaging GMbH, Німеччина).

    Визначення експресії eNos, Tnf і Il-1?

    методом кількісної полімеразної

    ланцюгової реакції (КПЦР)

    Тканина аорти забирали, гомогенизировали і 10 хвилин інкубували при 37 ° С в розчині «Extract RNA». Після лізірованіе зразка в реагенте його піддали хлороформно чищенні, а осад, що утворився РНК промивали ізопропіловий спирт і 70% -ним етиловим спиртом. Концентрацію отриманої РНК вимірювали на спектрафотометре IMPLENNanoPhotometer®. Вихід РНК становив приблизно 1000 нг / мкл.

    Зворотну транскрипцію проводили з використанням набору MMLVRTSK021 відповідно до протоколу фірми-виробника (Evrogen). Суміш акуратно перемішували і протягом 2 хвилин прогрівали при 70 ° C для розплавлювання вторинних структур РНК і наступного відпалу праймера OligoDT. Після переносили зразки в лід. Всю реакційну суміш інкубували 60 хв при 40 ° C в термоциклов-ре T100 ™ ThermalCycler (Bio-Rad). Для зупинки реакції прогрівали суміш при 70 ° C протягом 10 хвилин. Отриману кДНК розводили до концентрації 1 нг / мкл.

    Рівень експресії гена оцінювали щодо значень референсного гена Gapdh. Розрахунок експресії в конкретній точці проводився за формулою: Експресія гена = 2л [(Ct (Gapdh) -Ct (Ген інтересу)] (таб. 1).

    Вивчення протромботичні активності

    40 щурів, були розділені на 5 рівних груп:

    1) EPO (2,5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г);

    2) EPO (5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 15 мкг / 100 г);

    3) P-aB (2,5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г);

    4) P-aB (5 мкг / 100 г 3 рази на добу протягом 7 днів, сумарна доза 15 мкг / 100 г);

    5) 0,9% розчин натрію хлориду (0,1 мл / 100 г 3 рази на добу протягом 7 днів, сумарна доза 0,3 мл / 100 г).

    Через 24 години після останньої ін'єкції препарату (розчинника для контрольної групи) тварин наркотизуйте і фіксували до операційного столика. Потім виконували розріз завдовжки 10 мм зліва від серединної лінії шиї, виділяли загальну сонну артерію і акуратно відокремлювали її від навколишніх тканин, не пошкоджуючи блукаючий нерв. З використанням ультразвуковадоплерографія Мінімакс-Допплер (Санкт-Петербург, Росія) на виділеній артерії визначали точку найкращого сигналу, після чого прикладали ватку, змочену 50% розчином заліза (III) хлориду і засікали час до зниження вихідного сигналу до = 10%. При виконанні всіх маніпуляцій тваринам було присвоєно унікальний код і хірург не знав приналежність тварини до групі.

    Статистичний аналіз

    Статистичну обробку проводили з використанням програмного середовища обчислень R. Характер розподілу ознак у статистичній вибірці визначали за допомогою критерію Шапі-ро-Уілкі і критерію Шпігельхальтера (бібліотека normtest), оцінку рівності дисперсій - за допомогою критерію Льовені (бібліотека lawstat). Залежно від типу розподілу ознак і рівності дисперсій значимість отриманих результатів оцінювали із застосуванням параметричного (ANOVA) або непараметрического (критерій Краскела-Уоллі-са) однофакторного дисперсійного аналізу, а в якості post-hoc аналізу для виявлення відмінностей при міжгрупових порівняннях використовували непарний t- критерій Стьюдента або критерій Манна-Уїтні, відповідно, з поправкою Бенджамін-Хохбер-га на множинну перевірку гіпотез. Результати вважали достовірними при p<0,05.

    РЕЗУЛЬТАТИ

    Оцінка ендотеліальної дисфункції

    8-денний введення L-NAME (2,5 мг / 100 г) призвело до значного зростання артеріального тиску. При цьому терапія EPO і P-aB статистично значуще не вплинула на значення систолічного і діастоли-тичного артеріального тиску (таб. 2).

    У той же час проведення функціональних проб з ацетилхоліном і натрію нітропрусидом виявило істотний ефект терапії щодо NO-Продуція-рующей функції ендотелію (рис.1). Група, отримувала L-NAME та 0,9% розчин натрію хлориду, продемонструвала майже 5-кратне збільшення КЕД (5,1 ± 0,15 у.о. при 1,21 ± 0,09 у інтактних тварин). У групі із застосуванням EPO і P-aB цей показник склав 3,81 ± 0,14 і 2,72 ± 0,12, відповідно.

    ISSN 2307-9266 e-ISSN 2413-2241

    Науково-практичний журнал

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    Таблиця 1 - Праймери для визначення експресії мРНК цільових і референсних генів

    Назва праймерів Послідовність нуклеотидів 5 '->3 'Температура плавлення (° С) Довжина ПЛР-продукту (пар нуклеотидів)

    Il-1b F TCGTGCTGTCTGACCCATGT 61,47 126

    Il-1b R AGGCCACAGGGATTTTGTCG 60,61

    eNos F GCCAACTCAAGGCAGGAGAC 60,96 129

    eNos R ATCCCCGGAAGGGTGCAATA 60,99

    Tnf-alph8 F TGAACTTCGGGGTGATCGGT 61,19 152

    Trf-alph ^ R CGCTTGGTGGTTTGCTACGA 61,2

    Gapdh F AGTGCCAGCCTCGTCTCATA 60,68 141

    GapdhR TGAGG TCAATGAAGGGGTCGT 61,11

    Таблиця 2 - Вплив ЕРО і 11-амінокислотного пептиду P-aB на артеріальний тиск щурів при моделюванні L-NAME-індукованої ендотеліальної дисфункції

    Група САД (мм рт.ст.) ДАТ (мм рт.ст.)

    Інтактні 121,5 ± 3,4 97,5 ± 3,1

    ЕД + NaCl (0,9%) 189,9 ± 4,8 133,2 ± 4,1

    ЕД + EPO 186,0 ± 5,1 133,2 ± 4,5

    ЕД + P-aB 190,3 ± 4,3 134,3 ± 3,9

    **

    Н h

    Інтактні ЕД + NaCI ЕД + ЕРО ЕД + Р-аВ

    (2,5 мкг / 100 г) (2,5 мкг / 100 г)

    er • < »1

    • • « .......

    M.tFC * * |

    г *

    . *

    , ; / I

    Ш Про

    vi "

    i "А

    .?-gr »?

    : л

    I. ««

    | W

    Інтактні ЕД + NaCI ЕД + EPO (2,5мкг / 100 г)

    Малюнок 1 - Морфофункціональний стан судинної стінки

    ЕД + Р-аВ (2,5 мкг / ЮОг)

    Примітка: А) Вплив ЕРО і Р-аВ на коефіцієнт ендотеліальної дисфункції, розрахований як відношення площі над кривою падіння тиску при проведенні ендотелійнезавісімой вазодилатації до площі над кривою падіння тиску при проведенні ендотелійзалежної вазодилатації; Б) Гістологічна картина стінки абдомінальної аорти. Інтактні - Ендотеліальна вистилання неперервна, ендотеліоцити плоскі. Ознак набряку і інфільтрації немає. Архітектоніка не порушена, співвідношення шарів збережено; ЕД + 0,9% розчин натрію хлориду - Спостерігається набряк зовнішньої оболонки, круглоклеточная інфільтрація середньої оболонки і вакуольна дистрофія гладких міоцитів. Щільність клітин висока. Співвідношення шарів змінено, в порівнянні з інтактними тваринами, ендотеліоцити набряклі, більшість з них слущить з поверхні базальної мембрани; ЕД + ЕРО - Спостерігається поліморфноклеточная інфільтрація зовнішньої оболонки судини, на тлі порушень архітектоніки середньої оболонки і початковими ознаками фіброзу; ЕД + Р-аВ - У препараті візуалізується повна схоронність архітектоніки шарів стінки судини. Ендотеліальна вистилання збережена, ендотеліоцити розташовані в один шар на базальній мембрані. Ознак перицелюлярний-го і периваскулярного набряку немає (Забарвлено гематоксиліном і еозином. Ув. 400). * - р<0,05; ** - р<0,01.

    PHARMACY & DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    PHARMACOLOGY

    Гістологічна картина стінки аорти

    Під час гістологічного дослідження визначена аналогічна тенденція, яка характеризує ендотелію-опротектівную активність ЕРО і Р-аВ (рис. 1Б).

    - L-NAME + 0,9% розчин натрію хлориду. У групі тварин з L-NAME-індукованої ЕД виявлені значні морфологічні зміни в порівнянні з інтактними тваринами, які полягали в наявності ознак периваскулярного і перицелюлярний набряку, запалення всіх оболонок стінки судини (аорти). У периваскулярной тканини зазначалося наявність поодиноких діапедезних крововиливів, а в просвіті судини наявність пристінкових микротромбов. В області ендотелію-альної вистилки спостерігалося набухання ендотеліоцит-тов, злущування їх з поверхні базальної мембрани. У невеликих ділянках зі збереженим ендотелієм ядра клітин розташовувалися уздовж стінки кровоносної судини. В одиничних ендотеліоцитах відзначався каріолізис і вакуолізація цитоплазми, зморщування клітин, аж до їх загибелі. Мала місце круглоклеточная інфільтрація середньої і зовнішньої оболонок. У середній оболонці, в гладких міоцитах відзначалася вакуольна дистрофія. У зовнішній оболонці спостерігалося разволокнение і наявність ознак набряку. Щільність клітин як в середній, так і в зовнішній оболонках висока.

    - L-NAME + EPO (2,5 мкг / 100 г). У даній групі спостерігалася поліморфноклеточная інфільтрація зовнішньої оболонки судини, на тлі незначних порушень архітектоніки еластичних мембран, наявності функціонально активних фібробластів (клітини з темно-базофильной цитоплазмой, великих розмірів візуалізуються в центрі середньої оболонки), що може свідчити про початкових ознаках фіброзу. Візуалізувалося невелика кількість реактивно-змінених гладких міоцену-тов, розташованих між закінчать еластичними мембранами. При цьому, більшість ендоте-ліоцітов мали уплощенную форму і розташовувалися безперервно, їх ядра орієнтовані паралельно базальній мембрані.

    ^^ АМЕ + Р-аВ (2,5 мкг / 100 г). При вивченні гістологічних зрізів в групі тварин після фармакологічної корекції Р-аВ була виявлена ​​майже повна схоронність архітектоніки шарів стінки судини. Співвідношення товщини шарів не мало візуальних відмінностей в порівнянні з даними интактной групи тварин. Спостерігалося збереження ендоте-ліальной вистилання, розташування ендотеліоцитів в один шар на базальній мембрані, плоска форма клітин і слабо оксифильная цитоплазма. Ядра палочковидной форми, орієнтовані уздовж кровоносної судини. Ознак перицелюлярний і периваскулярного набряку НЕ візуалізувалося.

    Виявлено трохи підвищена щільність клітин на одиниці площі зрізу, однак без ознак деструкції, яка спостерігалася у тварин без фармакологічної терапії.

    Експресія eNos, Tnf і Il-1?

    за даними кількісної ПЛР

    При моделюванні L-NAME-індукованої ЕД в порівнянні з інтактними тваринами у всіх групах виявлено збільшення відносної експресії мРНК гена eNos. При цьому експресія eNOS зростає в ряду: ЕД + 0,9% розчин натрію хлориду <ЕД + ЕРО <ЕД + Р-аВ. Рівень мРНК генів прозапальних цитокінів 7л / і Il-1? характеризувалося найбільшим збільшенням в групі ЕД без терапії, а застосування EPO і P-aB знижувало ступінь їх експресії (рис. 2).

    Оцінка протромботичні активності

    При оцінці часу настання заліза (III) хло-ріда-індукованого тромбозу у тварин, протягом 8 днів, які отримували EPO і P-aB, було виявлено дозозалежне скорочення часу тромбообразующіх-вання. Найбільш значний протромботичні ефект продемонстрував EPO, який скоротив час тромбоутворення до 16,7 ± 1,2 хв (2,5 мкг / 100 г) і 14,2 ± 1,3 хв (5 мкг / 100 г) в порівнянні з 19, 5 ± 0,9 хв в групі без застосування препаратів. P-aB в дозі 1,25 мкг / 100 г статистично значимо не вплинув на час тромбоутворення, а в дозі 2,5 мкг / 100 г прискорив тромбоз сонної артерії до 16,2 ± 1,1 хв (рис. 3).

    ОБГОВОРЕННЯ

    Наша робота показала, що 11-амінокислотний пептид P-aB, що володіє виборчим спорідненістю до гетеродімерному рецептора EPOR / CD131, здатний знижувати пошкодження ендотелію при L-NAME-индуцируемом дефіциті оксиду азоту. Блокада eNOS привела до стійкої гіпертензії, що спровокувала морфологічні зміни стінки судин, які виражалися в її гіпертрофії, некрозі і порушення архітектоніки.

    З використанням молекулярно-біологічно-го аналізу ми виявили підвищення експресії мРНК гена eNos, що по всій видимості є компенсаторною реакцією на гіпертензію. Поряд з цим зріс рівень прозапальних цитокінів -TNF-a і IL-1 ?. Триразове застосування P-aB в дозі 2,5 мкг / 100 г не вплинуло на артеріальну гіпертензію, пов'язану з введенням L-NAME, проте призвело до більш вираженого збільшення експресії мРНК гена eNos. Можливо, це пояснюється тим, що за рахунок антіапоптіческіх властивостей P-aB підвищив кількість функціонуючих клітин, які здатні синтезувати eNOS.

    Примітно, що в групі з застосуванням EPO, незважаючи на зниження КЕД, рівень мРНК гена eNos достовірно не збільшився щодо контролю. Це узгоджується з даними, отриманими Sultan F. та ін., Що демонструють, що EPO, здатний пригнічувати експресію eNOS [19]. По всій видимості, це властивість якісно відрізняє вазотропних активність P-aB від інших препаратів еритропоетинових ряду.

    ISSN 2307-9266 e-ISSN 2413-2241

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    eNos

    **

    in

    Інтектние ЕД + NaCI

    ЕД + ЕРО ЕД + Р-аВ [2,5 мкг / 100 г) (2,5 мкг / 100 г)

    J "

    5 12 >•

    |g 10

    до: 8 х

    ^ 6 До

    s 4

    і н і

    а. 2

    З

    0

    1 0

    Інтектние

    ЕД + NaCI Б

    ЕД + ЕРО i, 5 мкг / 100 г)

    ЕД + Р-аВ (2,5 мить / 100 г)

    А

    et

    Ol

    ?ВД-1

    Е з

    i2-5? 2

    S15

    S

    U 1

    U J-01

    § "0,5 (Й Про

    Інтектние

    ЕД + NaCI

    В

    ЕД + ЕРО (2,5 ^ нг / 100г)

    ЕД + Р-аВ (2,5 wHr / 100 г)

    Малюнок 2 - Вплив EPO і P-аВ на експресію мРНК генів eNos, Tnf і Il-1? в абдомінальній аорті на тлі моделювання L-NAME-індукованої ЕД (за даними кількісної ПЛР)

    Примітка: * - p<0,05; ** - p<0,01.

    i 25 I 20

    ж Про до? ai

    15

    10

    5

    NaCI

    EPO (2,5 мкг / 100 г)

    ЕРО (5 мкг / 100 г)

    Р-аВ (2,5 мкг / 100 г)

    Р-аВ (5 мкг / 100 г)

    Малюнок 3 - Вплив EPO і P-аВ на час FeCl3-індукованої тромботической оклюзії сонної артерії (зниження ДОППЛЄРОГРАФІЧНІ сигналу до рівня = 10% від вихідного)

    Примітка: * - p<0,05.

    Scientific and Practical Journal

    PHARMACY & PHARMACOLOGY

    RESEARCH ARTICLE

    DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    Отримані результати також свідчать, що Р-аВ здатний запобігати запальну активацію в моделі L-NAME-індукованої ЕД. Цей феномен швидше за все пов'язаний як з антіапопті-чеський активністю сполуки, так і з власної протизапальну активність молекул Ері-тропоетінового ряду. Дана властивість дуже значимо для потенційного атеропротектора, оскільки зниження цитокиновой активації необхідно для стабілізації атеросклеротичної бляшки і попередження її розриву.

    Нарешті, останній етап дослідження з використанням FeCl3-індукованого тромбозу сонної артерії у щурів виявив, що Р-аВ володіє протріть-ботіческімі властивостями. Протромботичні активність Р-аВ виражена в меншій мірі, ніж у ЕРО і в нашому дослідженні не проявилася в тих дозах, в яких він демонструє ендотеліопротектівное дію (2,5 мкг / 100г х 3 протягом 7 днів). Проте, ця властивість є значущим обмеженням в позиціонуванні Р-аВ як засіб для профілактики і лікування серцево-судинних захворювань, пов'язаних з атеросклерозом.

    Ми бачимо перспективу в модифікації Р-аВ шляхом приєднання пептидних мотивів, що володіють антиагрегантну активність. Для усунення протромботичні активності до Р-аВ можуть бути додані амінокислотні послідовності

    і Lys-Gly-Asp. Відомо, що і Lys-Gly-Asp мають виражені антиагрегант-ними властивостями [20-22]. У ряді вітчизняних робіт також були виявлені антитромботические і

    антиагрегаційні властивості іншого допоміжного аминокислотного трипептида Рго ^ 1У-РДА. [23-25]. Крім того, Рго ^ 1У-РДА стабілізує молекулу в біологічних середовищах за рахунок пригнічення активності протеолітичних ферментів [26] і має здатність блокувати ангіотензин-перетворені-ющий фермент [27], один з найважливіших проатеро-генних чинників, який каталізує реакцію утворення ангіотензину II і сприяє ремо-делірованію судинної стінки [28]. Ключовим питанням залишається характер (позиція, лінкери і т.д.) для вбудовування даних амінокислотних послідовностей в базисну молекулу. Біоінфор-тичних аналіз дозволить визначити найбільш оптимальні локалізації для приєднання три- пептидів, що дозволяють не впливати на питання, що цікавлять фармакофор, зберігши і ендотеліопротектівную, і антиагрегантну активність.

    ВИСНОВОК

    11-амінокислотний пептид, що імітує а-спіраль У еритропоетину, має виражену ендотеліопротектівним і, потенційно, атеро-протективного дією через здатність запобігати загибель ендотеліоцитів, а також знижувати ремоделювання і прозапальну активацію судинної стінки. Проте, протромботіче-ська активність Р-аВ обмежує його застосування в якості засобу для профілактики і лікування ате-росклероз-асоційованих захворювань і обумовлює необхідність подальших модифікацій даної молекули.

    ФІНАНСОВА ПІДТРИМКА

    Робота виконується за підтримки Міністерства освіти та науки Росії. Угода про субсидії № 05.605.21.0109 (унікальний ідентифікатор угоди RFMEFI60519X0191).

    КОНФЛІКТ ІНТЕРЕСІВ

    Автори заявляють про відсутність конфлікту інтересів.

    АВТОРСЬКИЙ ВНЕСОК

    М.В. Корокін - написання статті, розробка дизайну дослідження, пробопідготовка зразків для гістологічного дослідження, морфологічне описі зрізів стінки аорти; В.О. Солдатов - написання статті, розробка дизайну дослідження; А. Титце - синтез пептиду, аналіз літератури; І.В. Голубєв - введення препаратів тваринам, моделювання L-NAME-індукованої ендотеліальної дисфункції; А.Е. Білих - виділення мРНК, проведення реакції зворотної транскрипції, аналіз експресії мРНК генів eNos, Tnf і Il-1 ?, переклад статті; М.В. Кубекіна - виділення мРНК, проведення реакції зворотної транскрипції, аналіз експресії мРНК генів eNos, Tnf і Il-1 ?, формалізація списку використаних джерел, робота з графічним матеріалом; О.А. Пученкова - участь у всіх етапах роботи з тваринами, виділення РНК, забір зразків для гістологічного дослідження; Т.А. Денисюк - участь в оцінці коефіцієнта ендотеліальної дисфункції; В.В. Гуреєв - оцінці коефіцієнта ендотеліальної дисфункції; Т.Г. Покровська - консультація з питань планування, методології та реалізації експерименту; О.С. Гудир - оцінка протромботичні активності, аналіз літератури; М.А. Жученко - синтез пептиду, аналіз літератури; М.А. Затолокіна - пробопідготовка зразків для гістологічного дослідження, морфологічне описі зрізів стінки аорти; М.В. Покровський - ідея, планування дослідження, консультація з питань проведення окремих етапів експериментальних робіт.

    СПИСОК

    Глушко А.А., Воронков А.В., Черніков М.В. Молекулярні мішені для пошуку речовин, що володіють ендотеліопро-текторнимі властивостями (оглядова стаття) // Біоорганічна хімія. 2014. Т. 40. № 5. С. 515-527. DOI: 10.7868 / S0132342314050066.

    Тюренков І.М., Воронков А.В., Сліецанс А.А., Волотова Е. В. Ендотеліопротектори - новий клас фармакологічних препаратів // Вісник Російської академії медичних наук. 2012 Т. 67, №7. - С. 50-57. DOI: https://doi.org/10.15690/ vramn.v67i7.341

    Zarate A., Manuel-Apolinar L., Basurto L., De la Chesnaye E.,

    Saldivar I. Cholesterol and atherosclerosis. Historical considerations and treatment // Arch Cardiol Mex. - 2016. - V. 86, N 2. - P. 163-9. doi: 10.1016 / j.acmx.2015.12.002. Epub 2016 Jan 7. Orekhov A.N., Poznyak A.V., Sobenin I.A., Nikifirov N.N., Ivanova E.A. Mitochondrion as a selective target for treatment of atherosclerosis: Role of mitochondrial DNA mutations and defective mitophagy in the pathogenesis of atherosclerosis and chronic inflammation // Curr Neuropharmacol. 2019. doi: 10.217 4 / 1570159X17666191118125018. [Epub ahead of print]. Marzetti E., Calvani R., Cesari M., Buford T.W., Lorenzi M., Behnke B.J., Leeuwenburgh C. Mitochondrial dysfunction and sarcopenia of aging: from signaling pathways to clinical trials //

    ISSN 2307-9266 e-ISSN 2413-2241

    Int J Biochem Cell Biol. - 2013. - V. 45, N 10. - P. 2288-301. doi: 10.1016 / j.biocel.2013.06.024.

    6. Воронков А. В., Поздняков Д. І., Мірошниченко К. А., Потапова А. А. Вплив нових похідних піримідину на вазо-ділатірующее функцію ендотелію судин головного мозку в умовах хронічної травматичної енцефалопатії // Експериментальна і клінічна фармакологія. 2019. Т. 82. № 11. С. 11-14. DOI: 10.30906 / 0869-2092-2019-82-11-11-14.

    7. Воронков А.В., Поздняков Д.І. Оцінка впливу 4-гідроокис-сі-3,5-ді-трет-бутілкорічной кислоти на зміни ан-тітромботіческого потенціалу ендотелію у кроликів в умовах ішемії головного мозку // Експериментальна і клінічна фармакологія. 2018. Т. 81. № 8. С. 3-7. DOI: 10.30906 / 0869-2092-2018-81-8-3-7

    8. Gimbrone M.A. Jr., Garcia-Cardena G. Endothelial cell dysfunction and the pathobiology of atherosclerosis // Circ Res. - 2016. - V. 118, N 4. - P. 620-636. doi: 10.1161 / CIRCRESAHA.115.306301.

    9. Єлагін, В.В. Підходи до корекції ішемічних і реперфузійних пошкоджень нирок в експерименті В.В.. Єлагін, О.І. Братчиків, А.А. Ульянова // Наукові результати біомедичних досліджень. -2018. - №4 (3). - С. 63-69. doi: 10.18413 / 2313-8955- 2018-4-3-0-6.

    10. Shabelnikova A.S., Lutsenko VD., Pokrovskii M.V, Peresipkina A.A., Korokin M.V, Gudyrev O.S., Hoshenko YA. Protective effects of recombinant erythropoietin in ischemia of the retina: The role of mechanisms of preconditioning // Research Journal of Medical Sciences.

    - 2015. - V 9, N 4. - P 200-203. doi: 10.3923 / rjmsci.2015.200.203.

    11. Корокіна, Л.В. Фармакологічна корекція L-NAME індукованого дефіциту оксиду азоту рекомбінантним ерітропо-Етін / Л.В. Корокіна, І.М. Колесник, M ^. Покровський, М.В. Корокін, А.С. Білоус, Є.Б. Артюшкова, Т.Г. Покровська, О.С. Гудир, А.Е. Корольов, Л.А. Павлова, О.О. Новиков // Кубанський науковий медичний вісник. - 2009. - №9 (114). - С. 66-69.

    12. Denisyuk T. Pharmacotherapeutic strategies for endothelial dysfunction correction with use of statins in syndrome of systemic inflammatory response // Research Results in Pharmacology. - 2017.

    - V. 3, N 4. - P. 35-77. doi: 10.18413 / 2313-8971-2017-3-4-35-77.

    13. Денисюк, Т.А. Одночасне застосування рекомбінатного Ері-тропоетіна і статинів при ендотоксініндуцірованной ендо- теліальной дисфункції / Т.А. Денисюк, М.В. Покровський // Алергологія та імунологія. - 2016. - №17 (1). - С. 64-65.

    14. Rajkumar D.S.R., Gudyrev O.S., Faiteison A.V., Pokrovskii M.V. Study of the microcirculation level in bone with osteoporosis and osteoporotic fractures during therapy with recombinant erythropoietin, rosuvastatin and their combinations // Research result: pharmacology and clinical pharmacology. -2015. - V. 4, N 6. - P. 57-60. doi: 10.18413 / 2313-8971-2015-1-4-57-60.

    15. Souvenir R., Doycheva D., Zhang J.H., Tang J. Erythropoietin in stroke therapy: friend or foe // Curr Med Chem. - 2015. - V. 22, N 10. - P. 1205-13.

    16. Pearl R.G. Erythropoietin and organ protecttion: lessons from negative clinical trials // Crit Care. -2014. - V. 18, N 5. - P. 526. doi: 10.1186 / s13054-014-0526-9.

    17. Brines M., Grasso G., Fiordaliso F., Sfacteria A., Ghezzi P., Fratelli M.,

    Корокін Михайло Вікторович - доктор медичних наук, доцент, професор кафедри фармакології та клінічної фармакології, ФГАОУ У «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 0000-0001-5402-0697. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Солдатов Владислав Олегович - асистент кафедри фармакології та клінічної фармакології, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 0000-0001-9706-0699. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Алеся Титце - старший викладач, доцент кафедри хімії і молекулярної біології, відділ медичної хімії, що спеціалізується на синтезі біоактивних пептидів, Гетеборзький університет. ORCID ID: 0000-0002-9281-548X. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її. Голубєв Іван Володимирович - здобувач кафедри фармакології та клінічної фармакології, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 0000-0002-3754-0380. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Білих Андрій Євгенович - кандидат медичних наук, доцент кафедри патофізіології, ФГБОУ ВО «Курський державний медичний університет» МОЗ Росії. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її. Кубекіна Марина Владиславівна - аспірант, ФГБУН «Інститут біології гена РАН». ORCID ID: 0000-0002-8834-1111. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Пученкова Олеся Андріївна - студент 5 курсу Медичного інституту, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 0000-0002-7657-0937. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Денисюк Тетяна Олексіївна - доктор медичних наук, доцент кафедри фармакології, ФГБОУ ВО «Курський державним-

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    Latini R., Xie Q.W., Smart J., Su-Rick C.J., Pobre E., Diaz D., Gomez

    D., Hand C., Coleman T., Cerami A. Erythropoietin mediates tissue protection through an erythropoietin and common beta-subunit heteroreceptor // Proc Natl Acad Sci U S A. -2004. - V. 101, N 41. -P. 14907-12. doi.org/10.1073/pnas.0406491101.

    18. Brines M., Patel NS, Villa P., Brines C., Mennini T., De Paola M., Erbayraktar Z., Erbayraktar S., Sepodes B., Thiemermann C., Ghezzi P., Yamin M., Hand CC, Xie QW, Coleman T., Cerami A. Nonerythropoietic, tissue-protective peptides derived from the tertiary structure of erythropoietin // Proc Natl Acad Sci USA. -2008. - V. 105, N 31. - P. 10925-30. doi: 10.1073 / pnas.0805594105.

    19. Sultan F., Singh TU, Kumar T., Rungsung S., Rabha DJ, Vishwakarma A., Sukumaran SV, Kandasamy A., Parida S. Short-term exposure of erythropoietin impairs endothelial function through inhibition of nitric oxide production and eNOS mRNA expression in the rat pulmonary artery // Pharmacol Rep. -2017.

    - V. 69, N 4. - P. 658-665. doi: 10.1016 / j.pharep.2017.02.003.

    20. Pytela R., Pierschbacher M.D., Ginsberg M.H., Plow E.F., Ruoslahti

    E. Platelet membrane glycoprotein Ilb / IIIa: member of a family of Arg-Gly-Asp - specific adhesion receptors // Science. -1986. - V. 231, N 4745. - P. 1559-62. doi: 10.1126 / science.2420006.

    21. Sheu J.R., Yen M.H., Peng H.C., Chang M.C., Huang T.F. Triflavin, an Arg-Gly-Asp-containing peptide, prevents platelet plug formation in in vivo experiments // Eur J Pharmacol. -1995. - V. 294, N 1. -P. 231-8. doi: 10.1016 / 0014-2999 (95) 00530-7.

    22. Hung Y.C., Kuo Y.J., Huang S.S., Huang T.F. Trimucrin, an Arg-Gly-Asp containing disintegrin, attenuates myocardial ischemia-reperfusion injury in murine by inhibiting platelet function // Eur J Pharmacol.

    - 2017. - V. 813. - P. 24-32. doi: 10.1016 / j.ejphar.2017.07.039.

    23. Pastorova V.E., Liapina L.A., Alshmarin I.P., Ostrovskaia P.U., Gudasheva T.A., Lugovskoi E.V. Fibrin-depolymerization activity and the antiplatelet effect of small cyclic and linear proline-containing peptides // Izv Akad Nauk Ser Biol. - 2001. - N. 5. - P. 593-6.

    24. Lyapina L.A., Pastorova V.E., Obergan T.Y. Changes in hemostatic parameters after intranasal administration of peptide Pro-Gly-Pro // Bull Exp Biol Med. -2007. - V. 144, N 4. - P. 491-3. doi: 10.1007 / s10517-007-0358-6.

    25. Liapina L.A., Grigor'eva M.E., Andreeva L.A., Miasoedov N.F. Protective antithrombotic effects of proline-containing peptides in the animal body subjected to stress // Izv Akad Nauk Ser Biol. -2010. - N 4. - P. 462-7.

    26. Shevchenko K.V., Nagaev I.Y., Andreeva L.A., Shevchenko V.P., Myasoedov N.F. Stability of prolin-containing peptides in biological media // Biomed Khim. - 2019. - V. 65, N 3. - P. 180201. doi: 10.18097 / PBMC20196503180.

    27. Wang Z., Zhang S., Jin H., Wang W., Huo J., Zhou L., Wang Y., Feng

    F., Zhang L. Angiotensin-I-converting enzyme inhibitory peptides: Chemical feature based pharmacophore generation // Eur J Med Chem. - 2011. - V. 46, N 8. - P. 3428-33. doi: 10.1016 / j. ejmech.2011.05.007.

    28. Montezano A.C., Nguyen Dinh Cat A., Rios F.J., Touyz R.M. Angiotensin II and vascular injury // Curr Hypertens Rep. -2014. - V. 16, N 6. -P. 431. doi: 10.1007 / s11906-014-0431-2.

    ний медичний університет »МОЗ Росії. ORCID ID: 0000-0003-0974-4818. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Гуреєв Володимир Володимирович - доктор медичних наук, доцент кафедри фармакології та клінічної фармакології, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 00000003-1433-1225. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Покровська Тетяна Григорівна - доктор медичних наук, професор, професор кафедри фармакології та клінічної фармакології, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 00000001-6802-5368. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Гудир Олег Сергійович - кандидат медичних наук, доцент, доцент кафедри фармакології та клінічної фармакології, ФГАОУ ВО «Бєлгородський державний університет» (НДУ «БєлДУ»). ORCID ID: 0000-0003-0097-000X. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Максим Андрійович Жученко - кандидат біологічних наук, начальник сектора, НДЦ «Курчатовський інститут» - ДержНДІ-генетика. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Затолокіна Марія Олексіївна - доктор медичних наук, доцент, професор кафедри гістології, цитології, ембріології, ФГБОУ ВО «Курський державний медичний університет» МОЗ Росії. ORCID ID: 0000-0002-9553-1597. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Покровський Михайло Володимирович - доктор медичних наук, професор, професор кафедри фармакології та клінічної фармакології, керівник НДІ Фармакології живих систем, ФГАОУ ВО «Бєлгородський державний університет» (НіУ «БєлДУ»). ORCID: 00000002-2761-6249. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.


    Ключові слова: АТЕРОСКЛЕРОЗ / ЕРИТРОПОЕТИН / ЩУРА / P-? B / ЦІБЕНІТІД / ендотелію / ATHEROSCLEROSIS / ERYTHROPOIETIN / RATS / CIBENITIDE / ENDOTHELIUM

    Завантажити оригінал статті:

    Завантажити