An 11-amino acid peptide imitating the natural structure of B erythropoietin ?-helix (P-? B), Has a specific affinity to the heterodimeric complex EPOR / CD131. The aim of the study was to test whether P-? B can be positioned as a preventing and treating agent for cardiovascular diseases. Materials and methods. The study was performed on sexually mature male Wistar rats. Endothelial dysfunction was modulated by a 7-days intraperitoneal administration of L-NAME at the dose of 2.5 mg / 100 g. P-? B, or erythropoietin (EPO), was used for therapy at the dose of 2.5? G / 100 g? 3 times for 7 days, the total dose was 7.5? G / 100 g. The function of endothelium was estimated by an endothelium-dependent and endothelium-independent vasodilation. In addition, a histological assessment of the abdominal aortic wall state and the analysis of eNos, Tnf and Il-1? genes expression were performed. To estimate prothrombotic properties, P-? B and EPO were administered, at the doses of 2.5 and 5? g / 100 g (3 times a day for 7 days, the total doses were 7.5? g / 100 g and 15? g / 100 g, respectively) and on the 8th day, the time of ferric (III) chloride-induced carotid artery thrombosis was estimated. Results. The results of the functional tests for endothelium-dependent and endothelium-independent vasodilatation, as well as the histological picture of the aorta have evidenced that P-? B and EPO do not affect L-NAME-induced hypertension but improve the endothelium function. At the same time, P-? B shows a significantly higher endothelial-protective activity, reducing the coefficient of endothelial dysfunction from 5.1 ± 0.15 to 2.72 ± 0.12. In addition, P-? B has significantly increased the expression of eNos and reduced the expression level of Tnf and Il-1? mRNA genes. Carrying out Ferric (III) chloride-induced carotid artery thrombosis has revealed that P-? B (5? G / 100 g? 3 times a day for 7 days, total dose was 15? G / 100 g) has a lower but statistically significant prothrombotic activity than EPO. Conclusion. P-? B can be positioned as an atheroprotector because of its ability to prevent the death of endothelial cells, as well as to reduce remodeling and proinflammatory activation of the vascular wall. However, the prothrombotic properties of P-? B limit its use as a preventing and treating agent for atherosclerosis-associated diseases.

Анотація наукової статті з фундаментальної медицини, автор наукової роботи - Mikhail V. Korokin, Vladislav O. Soldatov, Alesia A. Tietze, Ivan V. Golubev, Andrey E. Belykh


11-АМІНОКИСЛОТНИЙ ПЕПТИД, що імітують структуру A-СПІРАЛІ B еритропоетин, ПОЛІПШУЄ ФУНКЦІЮ ЕНДОТЕЛІЮ, АЛЕ СТИМУЛЮЄ тромбоутворення У ЩУРІВ

Мета. 11-амінокислотний пептид, що імітує природну структуру? -Спіралі B еритропоетину (P-? B) Має специфічний спорідненістю до гетеродімерному комплексу EPOR / CD131. У нашому дослідженні ми вирішили перевірити чи може P-? B позиціонуватися як засіб для профілактики і лікування серцево-судинних захворювань. Матеріали та методи. Дослідження виконано на статевозрілих самцях щурів лінії Wistar. дисфункцію ендотелію моделювали шляхом 7-денного внутрішньочеревно введення L-NAME в дозі 2,5 мг / 100 г. У якості терапії використовували P-? B або еритропоетин (EPO) в дозі 2,5 мкг / 100 г? 3 рази на добу протягом 7 днів, сумарна доза 7,5 мкг / 100 г. Функцію ендотелію оцінювали шляхом проведення ендотелійзалежної і ендотелійнезавісімой вазодилатації. На додаток до цього проводили гістологічну оцінку стану стінки абдомінальної аорти і аналіз експресії генів eNos, Tnf і Il-1 ?. Для оцінки протромботичних властивостей P-? B і EPO вводили в дозах 2,5 і 5 мкг / 100 г (3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г і 15 мкг / 100 г, відповідно) і на 8-й день оцінювали час заліза ( III) хлорид-індукованого тромбозу сонної артерії. результати. P-? B і EPO не впливають на L-NAME-індуковану гіпертензію, проте покращують функцію ендотелію, про що свідчать результати функціональних проб на ендотелійзалежну і ендотелійнезавісімую вазодилатацию, а також гістологічна картина аорти. При цьому P-? B демонструє значно більшу ендотеліопротектівную активність, знижуючи коефіцієнт ендотеліальної дисфункції з 5,1 ± 0,15 до 2,72 ± 0,12. Крім того, P-? B значно збільшив експресію eNos, і знизив рівень експресії мРНК генів Tnf і Il-1 ?. При проведенні заліза (III) хлорид-індукованого тромбозу сонної артерії виявлено, що P-? B (В дозі 5 мкг / 100 г? 3 рази протягом 7 днів, сумарна доза 15 мкг / 100 г) має меншу, ніж EPO, але статистично значущою протромботичні активністю. висновок. P-? B може позиціонуватися як атеропротектора через здатність запобігати загибель ендотеліоцитів, а також знижувати ремоделювання і прозапальну активацію судинної стінки. Проте протромботичні властивості P-? B обмежують його застосування в якості засобу для профілактики і лікування атеросклерозу-асоційованих захворювань.


Область наук:
  • фундаментальна медицина
  • Рік видавництва: 2019
    Журнал: Фармація і фармакологія

    Наукова стаття на тему '11 -AMINO ACID PEPTIDE IMITATING THE STRUCTURE OF ERYTHROPOIETIN? -HELIX B IMPROVES ENDOTHELIAL FUNCTION, BUT STIMULATES THROMBOSIS IN RATS '

    Текст наукової роботи на тему «11-AMINO ACID PEPTIDE IMITATING THE STRUCTURE OF ERYTHROPOIETIN? -HELIX B IMPROVES ENDOTHELIAL FUNCTION, BUT STIMULATES THROMBOSIS IN RATS»

    ?ISSN 2307-9266 e-ISSN 2413-2241

    PHARMACY& PHARMACOLOGY

    iwm

    11-amino acid peptide imitating the structure of erythropoietin a-helix b improves endothelial function, but stimulates thrombosis in rats

    M.V. Korokin1, V.O. Soldatov1, A.A. Tietze2, I.V. Golubev1, A.E. Belykh3, M.V. Kubekina4, O.A. Puchenkova1, T.A. Denisyuk3, V.V. Gureyev1, T.G. Pokrovskaya1, O.S. Gudyrev1, M.A. Zhuchenko5, M.A. Zatolokina3, M.V. Pokrovskiy1

    1 Belgorod State National Research University

    85, Pobeda St., Belgorod, Russia 308015

    2 University of Gothenburg, Department of Chemistry and Molecular Biology, Department of Organic and Medicinal Chemistry PO Box 462; 9 C, Medicine Aregatan St., Goteborg, Sweden

    3 Kursk State Medical University 3, Karl Marx St., Kursk, Russia 305041

    4 Institute of Gene Biology of the Russian Academy of Sciences 34/5, Vavilov St., Moscow, Russia 119334

    5 Scientific Research Centre, Kurchatov Institute 1, Akademik Kurchatov Square, Moscow, Russia 123098

    E-mail:

    Received 6 December 2019 Review (1) 20 December 2019 Review (2) 26 December 2019

    Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Accepted 27 December 2019

    An 11-amino acid peptide imitating the natural structure of B erythropoietin a-helix (P-aB), has a specific affinity to the heterodimeric complex EPOR / CD131.

    The aim of the study was to test whether P-aB can be positioned as a preventing and treating agent for cardiovascular diseases. Materials and methods. The study was performed on sexually mature male Wistar rats. Endothelial dysfunction was modulated by a 7-days intraperitoneal administration of L-NAME at the dose of 2.5 mg / 100 g. P-aB, or erythropoietin (EPO), was used for therapy at the dose of 2.5 ^ g / 100 g x 3 times for 7 days, the total dose was 7.5 ^ g / 100 g. The function of endothelium was estimated by an endothelium-dependent and endothelium-independent vasodilation. In addition, a histological assessment of the abdominal aortic wall state and the analysis of eNos, Tnf and II-18 genes expression were performed. To estimate prothrombotic properties, P-aB and EPO were administered, at the doses of 2.5 and 5 ^ g / 100 g (3 times a day for 7 days, the total doses were 7.5 ^ g / 100 g and 15 ^ g / 100 g, respectively) and on the 8th day, the time of ferric (III) chloride-induced carotid artery thrombosis was estimated.

    Results. The results of the functional tests for endothelium-dependent and endothelium-independent vasodilatation, as well as the histological picture of the aorta have evidenced that P-aB and EPO do not affect L-NAME-induced hypertension but improve the endothelium function. At the same time, P-aB shows a significantly higher endothelial-protective activity, reducing the coefficient of endothelial dysfunction from 5.1 ± 0.15 to 2.72 ± 0.12. In addition, P-aB has significantly increased the expression of eNos and reduced the expression level of Tnf and II-18 mRNA genes. Carrying out Ferric (III) chloride-induced carotid artery thrombosis has revealed that P-aB (5 ^ g / 100 gx 3 times a day for 7 days, total dose was 15 ^ g / 100 g) has a lower but statistically significant prothrombotic activity than EPO.

    Conclusion. P-aB can be positioned as an atheroprotector because of its ability to prevent the death of endothelial cells, as well as to reduce remodeling and proinflammatory activation of the vascular wall. However, the prothrombotic properties of P-aB limit its use as a preventing and treating agent for atherosclerosis-associated diseases. Keywords: atherosclerosis, erythropoietin, rats, P-aB, cibenitide, endothelium

    Abbreviations: P-aB - a-helix of B erythropoietin; EPO - erythropoietin; L-NAME - N (w) -nitro-L-arginine methyl ester; eNOS - endothelial nitric oxide synthase; ED - endothelial dysfunction; EDC - endothelial dysfunction coefficient; SBP - systolic blood pressure; DBP - diastolic blood pressure.

    For citation: M.V. Korokin, V.O. Soldatov, A.A. Tietze, I.V Golubev, A.E. Belykh, M.V Kubekina, O.A. Puchenkova, T.A. Denisyuk, V.V Gureyev, T.G. Pokrovskaya, O.S. Gudyrev, M.A. Zhuchenko, M.A. Zatolokina, M.V Pokrovskiy. 11-amino acid peptide imitating the structure of erythropoietin a-helix b improves endothelial function, but stimulates thrombosis in rats. Pharmacy & Pharmacology. 2019; 7 (6): 312-320. DOI: 10.19163 / 2307-9266-2019-7-6-312-320 © М.В. Корокін, В.О. Солдатов, А. Титце, І.В. Голубєв, А.Е. Білих, М.В. Кубекіна, О.А. Пученкова, Т.А. Денисюк, В.В. Гуреєв, Т.Г. Покровська, О.С. Гудир, М.А. Жученко, М.А. Затолокіна, М.В. Покровський, 2019

    Для цитування: М.В. Корокін, В.О. Солдатов, А. Титце, І.В. Голубєв, А.Е. Білих, М.В. Кубекіна, О.А. Пученкова, Т.А. Денисюк, В.В. Гуреєв, Т.Г. Покровська, О.С. Гудир, М.А. Жученко, М.А. Затолокіна, М.В. Покровський. 11-амінокислотний пептид, що імітує структуру a-спіралі b еритропоетину, покращує функцію ендотелію, але стимулює тромбоутворення у щурів. Фармація і фармакологія. 2019; 7 (6): 312-320. DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    ОРИГІНАЛЬНА СТАТТЯ

    DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    11-амінокислотний пептид, що імітує структуру a-спіралі b еритропоетину, покращує функцію ендотелію, але стимулює тромбоутворення у щурів

    М.В. Корокін1, В.О. Солдатов1, А. Тітце2, І.В. Голубев1, А.Е. Белих3, М.В. Кубекіна4, О.А. Пученкова1, Т.А. Денісюк3, В.В. Гуреев1, Т.Г. Покровская1, О.С. Гудирев1, М.А. Жученко5, М.А. Затолокіна3, М.В. Покровскій1

    1 ФГАОУ ВО «Бєлгородський державний університет» 308015, Росія, м Білгород, вул. Перемоги, 85

    2 Гетеборзький університет, факультет хімії і молекулярної біології, відділ органічної та медичної хімії

    41271, Швеція. Гетеборг, вул. Медицини Арегатан, 9C

    3 ФГБОУ ВО «Курський державний медичний університет» 305041, Росія, м Курськ, вул. Карла Маркса, 3

    4 ФГБУН «Інститут біології гена РАН» 119334, Россия, г. Москва, вул. Вавилова, 34/5

    5 НДЦ «Курчатовський інститут» - ДержНДІгенетика 123098, Россия, г. Москва, пл. Академіка Курчатова, 1

    E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Отримано 06.12.2019 Рецензія (1) 20.12.2019 Рецензія (2) 26.12.2019 Прийнята до друку 27.12.2019

    Мета. 11-амінокислотний пептид, що імітує природну структуру a-спіралі B еритропоетину (P-aB) має специфічний спорідненістю до гетеродімерному комплексу EPOR / CD131. У нашому дослідженні ми вирішили перевірити чи може P-aB позиціонуватися як засіб для профілактики і лікування серцево-судинних захворювань.

    Матеріали та методи. Дослідження виконано на статевозрілих самцях щурів лінії Wistar. Дисфункцію ендотелію моделювали шляхом 7-денного внутрішньочеревно введення L-NAME в дозі 2,5 мг / 100 г. У якості терапії використовували P-aB або ерітропо-Етін (EPO) в дозі 2,5 мкг / 100 г х 3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г. Функцію ендотелію оцінювали шляхом про-

    ведення ендотелійзалежної і ендотелійнезавісімой вазодилатації. На додаток до цього проводили гістологічну оцінку стану стінки абдомінальної аорти і аналіз експресії генів eNos, Tnf і Il-1 ?. Для оцінки протромботичних властивостей P-aB і EPO вводили в дозах 2,5 і 5 мкг / 100 г (3 рази протягом 7 днів, сумарна доза 7,5 мкг / 100 г і 15 мкг / 100 г, відповідно) і на 8 -й день оцінювали час заліза (III) хлорид-індукованого тромбозу сонної артерії.

    Результати. P-aB і EPO не впливають на L-NAME-індуковану гіпертензію, проте покращують функцію ендотелію, про що свідчать результати функціональних проб на ендотелійзалежну і ендотелійнезавісімую вазодилатацию, а також гістологічна картина аорти. При цьому P-aB демонструє значно більшу ендотеліопротектівную активність, знижуючи коефіцієнт ендоте-ліальной дисфункції з 5,1 ± 0,15 до 2,72 ± 0,12. Крім того, P-aB значно збільшив експресію eNos, і знизив рівень експресії мРНК генів Tnf і Il-1 ?. При проведенні заліза (III) хлорид-індукованого тромбозу сонної артерії виявлено, що P-aB (в дозі

    5 мкг / 100 г х 3 рази протягом 7 днів, сумарна доза 15 мкг / 100 г) має меншу, ніж EPO, але статистично значущою протріть-ботіческой активністю.

    Висновок. P-aB може позиціонуватися як атеропротектора через здатність запобігати загибель ендотеліоцитів, а також знижувати ремоделювання і прозапальну активацію судинної стінки. Проте протромботичні властивості P-aB обмежують його застосування в якості засобу для профілактики і лікування атеросклерозу-асоційованих захворювань. Ключові слова: атеросклероз, еритропоетин, щури, P-aB, цібенітід, ендотелій

    Список скорочень: P-aB - a-спіраль B еритропоетину; EPO - еритропоетин; L-NAME - N-нітро ^ -аргінін метиловий ефір; eNOS - ендотеліальна синтаза оксиду азоту; ЕД - ендотеліальна дисфункція; КЕД - коефіцієнт ендотеліальної дисфункції; САД -сістоліческое артеріальний тиск; ДАТ - діастолічний артеріальний тиск.

    INTRODUCTION

    The permanent growth of atherosclerosis-associated diseases in the overall structure of the death causes andthe disability rate in the developed countries, necessitatetheir in-depth study and the improvement of the correction methods [1, 2]. Hereby the experience accumulated since the first works by N.N. Anichkov [3] shows that the atherosclerotic damage of the vascular

    wall is a long-term multifactorial process [4]. According to the modern understanding of cardiovascular disease pathogenesis, endothelial dysfunction (ED) plays an integral role in the development of atherosclerosis and related complications [5-7]. The changes in the spectrum of molecules secreted and expressed by endothelium, and disruption of its barrier function, eventually lead to the vascular wall infiltration by atheromatous masses

    ISSN 2307-9266 e-ISSN 2413-2241

    and formation of atherosclerotic plaques [8]. The emerging pathogenetic cascade becomes an actual target for pharmacological influence [1, 2].

    An effective way to prevent the endothelium injury is the use of molecules with a universal cytoprotective activity [9]. One of such molecules is an endogenous glycoprotein - erythropoietin (EPO) [10]. A number of our studies have demonstrated that EPO is capable of significantly improving the morphofunctional state of the vascular wall when simulating ED in rats [11-14]. Nevertheless, a long-term experience shows that promising results of EPO preclinical studies are poorly translated into clinical reality and its main niche is still treatment of anemia [15-17].

    In 2004, Michael Brines et al. [17] proved that non-hematopoietic effects of EPO are realized via the heterodimeric complex of EPOR / CD131. The discovery of the fact that the erythropoiethic and tissue protective properties of EPO are realized by means of two different receptor systems, has led to the creation of prerequisites for a fundamentally new direction in the search for innovative molecules with a cytoprotective activity.

    In 2008, the same authors [18] presented the generalized results of the study of the cytoprotective activity of an 11-amino acid peptide based on erythropoietin a-helix B. It imitates the spatial part of the molecule that interacts with the heterodimeric EPOR / CD131 receptor, but does not interact with the homodimeric EPOR / EPOR receptor.

    This compound (P-aB, cibenitide, PubChem CID: 91810664) demonstrated the ability to significantly improve the morphofunctional state of tissues in diabetic macular edema, a renal ischemia / reperfusion injury, and significantly improve cognitive functions in the model of galantamine-induced amnesia in the absence of any effect on erythropoiesis.

    THE AIM of the research is to evaluate the endothelial- and atheroprotective activity of P-aB and to evaluate the prothrombotic properties of this molecule in order to identify the obstacles in the clinical use of P-aB as a preventing and treating agent for cardiovascular accidents.

    MATERIALS AND METHODS

    Animals

    The animals were obtained from the Charles River Laboratories Kennel (Massachusetts, USA). They were kept at the preclinical research center of the Research Institute of Pharmacology of Living Systems. After 14 days of quarantine, the rats were stratified by weight and placed by 9 individuals in separate conventional cages according to their experimental group. Before and during the study, the animals were kept in rooms with artificial lighting (12h / 12h mode) at 21-23 ° C, the humidity of 38-50%, and had a free access to food and water. The number of the conclusion of the Independent Ethical Committee is 06-09 / 02-1 dated 16 May 2019.

    PHARMACY& PHARMACOLOGY

    The experiment was performed on 76 male rats (200-220 g) of the Wistar line. The requirements of the Law of the Russian Federation "On Protection of Animals from Cruelty" dated 24 June 1998 the rules of laboratory practice during preclinical studies in the Russian Federation (GOST 3 51000.3-96 and GOST R 53434-2009), Directives of the European Community 86 / 609EU and the Rules of laboratory practice adopted in the Russian Federation (Order of the Ministry of Health of the Russian Federation No 708 dated 29 August 2010), were observed.

    Endothelial dysfunction modeling

    Endothelial dysfunction was modeled by a 7-days 'intraperitoneal administration of the blocker of endothelial nitric oxide synthase L-NAME (Sigma Aldrich, USA) at the dose of 2.5 mg / 100 g. To estimate the endothelial-protective effect of P-aB in comparison with EPO, 4 groups of 9 animals each, were formed of 36 male Wistar rats (200-220 g):

    1) ED + EPO (LLC "Pharmapark") (2.5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 7.5 ^ g / 100 g);

    2) ED + P-aB (Pharmapark LLC) (2.5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 7.5 ^ g / 100 g);

    3) ED + Solvent (0.9% sodium chloride solution 0.1 ml / 100 g, 3 times a day for 7 days, the total dose was 0.3 ml / 100 g);

    4) Intact + Solvent (0.9% sodium chloride solution 0.1 ml / 100 g, 3 times a day for 7 days, the total dose was 0.3 ml / 100 g).

    Exactly 24 hours after the last administration of L-NAME to each animal under anesthesia (Zolazepam (Virbac (France)) 6 mg / 100 g + Chloral hydrate (Panreac (Spain)) 15 mg / 100 g), the left carotid artery was catheterized for intravascular blood pressure monitoring using Biopac MP150. Endothelium-dependent (Acetylcholine, 4 ^ g / 100 g) and endothelium-independent (Sodium nitroprusside, 3 ng / 100 g) kinds of vasodilation were stimulated against the background of continuous blood pressure monitoring. Vasoactive agents were injected at the intervals of 15 minutes through a catheter installed in the femoral vein. During all manipulations, the animal was assigned a unique code and the surgeon did not know the animal's belonging to the group. The ratio of the area above the pressure drop curve during the administation of sodium nitroprusside to the area above the pressure drop curve during the administation of acetylcholine, was taken as the endothelial dysfunction coefficient (EDC) .After the functional vascular tests had been performed, the animals were euthanized by exsanguination and the abdominal part of the aorta was taken for histological studies, as well as for the evaluation of eNos, Il-1b and Tnf mRNA genes expression.

    Histology

    The samples of the abdominal aorta were fixed in

    Науково-практичний журнал ОРИГІНАЛЬНА СТАТТЯ

    ФАРМАКОЛОГІЯ DOI: 1019163 / 2307-9266-2019-7-6-312-320

    a 10% formaldehyde solution and then embedded into paraffin wax in a carousel-type machine "STP 120 (Microm International GmbH, Germany). Embedding of blocks with a standard orientation of pieces was carried out at the station for embedding biological material into paraffin wax EC 350 (Microm International GMBH, Germany). To ensure standardization, wax embedding was carried out in the form of multiblocks of 5-6 pieces each.

    The sections 5 microns thick for histological examination, were made on a semi-automatic rotary microtome with the system of transportation and distribution of sections "HM 340 E" (Microm International GmbH, Germany).

    Hematoxylin and eosin staining was carried out in a machine for staining histological sections and smears (Microm International GMbH, Germany).

    Hematoxylin and eosin staining was carried out in a machine for staining histological sections and smears (Microm International GmbH, Germany). A descriptive study of histological preparations was performed under the microscope Axio Scope A1 (Carl Zeiss Microimaging GmbH, Germany).

    Determination of eNos, Tnf and Il-ip expression

    by quantitative polymerase chain reaction (qPCR)

    The aortic tissue was taken out, homogenized and incubated in an "Extract RNA" solution for 10 minutes at 37 ° C. After the sample lysing in the reagent, it was chloroform cleaned, and the resulting RNA precipitate was washed with isopropyl alcohol and 70% ethyl alcohol. The concentration of the RNA was measured on an IMPLENNanoPhotometer®. The RNA yield was approximately тисячі ng / ^ l.A reverse transcription was performed using MMLVRTSK021 kit in accordance with the protocol of the manufacturer (Evrogen). The mixture was carefully mixed and heated for 2 minutes at 70 ° C to melt down the secondary RNA structures and the subsequent annealing of the OligoDT primer. Then the samples were transferred to ice. The entire reaction mixture was incubated for 60 min. at 40 ° C in the T100 ™ ThermalCycler (Bio-Rad). To stop the reaction, the mixture was heated at 70 ° C for 10 minutes. The obtained cDNA was diluted to the concentration of 1 ng / ^ l. The gene expression level was estimated relative to the Gapdh reference gene values. The calculation of the expression at a specific point was carried out by the formula: Gene expression = 2A [(Ct (Gapdh) -Ct (Gene of interest)] (Table 1).

    Prothrombotic Activity Study

    40 rats, divided into five equal groups:

    1) EPO (2.5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 7.5 ng / 100 g);

    2) EPO (5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 15 ^ g / 100 g);

    3) P-aB (2.5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 7.5 ng / 100 g);

    4) P-aB (5 ^ g / 100 g, 3 times a day for 7 days, the total dose was 15 ^ g / 100 g);

    5) 0.9% sodium chloride solution (0.1 ml / 100 g, 3 times a day for 7 days, the total dose was 0.3 ml / 100 g).

    24 hours after the last administration of the drug (or a solvent for the control group), the animals were anesthetized and fixed to the operating table. Then, a 10 mm incision was made to the left of the neck middle line, the common carotid artery was isolated and carefully separated from the surrounding tissues without damaging the vagus nerve. Using the ultrasound Minimax-Doppler (St. Petersburg, Russia), the best point for the signal was determined on the selected artery.

    After that, a cotton wool moistened with a 50% ferric (III) chloride solution was applied, and the time was had been fixed until the initial signal was reduced to = 10%. In all manipulations, the animal was assigned a unique code and the surgeon did not know the animal's belonging to the group.

    Statistical analysis

    Statistical processing was performed using the R programming language. In the statistical sample, the data distribution type was determined using the Shapiro-Wilk test and the Spiegelhalter test ( 'normtest' package), the evaluation of the variance equality was determined using the Levene's test ( 'lawstat' package). Depending on the data distribution type and the variance equality, the significance of the obtained results was assessed using a parametric (ANOVA) or nonparametric (Kruskal-Wallis H test) one-way analysis of variance. The unpaired Student's t-test or Wilcoxon-Mann-Whitney test, respectively, were used as post-hoc analyses to identify the differences in the intergroup comparisons, with Benjamini-Hochberg procedure to decrease the false discovery rate. The results were considered statistically significant at p<0.05.

    RESULTS

    Estimation of endothelial dysfunction

    An 8-day administration of L-NAME (2.5 mg / 100 g) resulted in a significant increase in blood pressure. At the same time, EPO and P-aB therapy had no statistically significant effect on systolic and diastolic blood pressure values ​​(Table 2).

    At the same time, the functional tests with acetylcholine and sodium nitroprusside revealed a significant effect of the therapy on the endothelium NO-producing function (Fig. 1A). The group treated with L-NAME and 0.9% sodium chloride solution, demonstrated almost 5-time increasing in EDC (5.1 ± 0.15 c.u. in contrast to 1,21 ± 0,09 in intact animals). In the group treated with EPO and P-aB, this indicator was 3.81 ± 0.14 and 2.72 ± 0.12, respectively.

    ISSN 2307-9266 e-ISSN 2413-2241

    PHARMACY& PHARMACOLOGY

    Table 1 - Primers for determination of mRNA expression of target and reference genes

    Primer name Nucleotide sequence 5 '->3 'Melting point (° C) PCR product size (nucleotide pairs)

    Il-1b F TCGTGCTGTCTGACCCATGT 61.47 126

    Il-1b R AGGCCACAGGGATTTTGTCG 60.61

    eNos F GCCAACTCAAGGCAGGAGAC 60.96 129

    eNos R ATCCCCGGAAGGGTGCAATA 60.99

    Tnf-alpha F TGAACTTCGGGGTGATCGGT 61.19 152

    Tnf-alpha R CGCTTGGTGGTTTGCTACGA 61.2

    Gapdh F AGTGCCAGCCTCGTCTCATA 60.68 141

    GapdhR TGAGGTCAATGAAGGGGTCGT 61.11

    Table 2 - Influence of EPO and 11-amino acid peptide P-aB on rat blood pressure in modeling L-NAME-induced endothelial dysfunction

    Group SBP (mm Hg) DBP (mm Hg)

    Intact 121.5 ± 3.4 97.5 ± 3.1

    ED + NaCI (0.9%) 189.9 ± 4.8 133.2 ± 4.1

    ED + EPO 186,0 ± 5.1 133.2 ± 4.5

    ED + P-aB 190.3 ± 4.3 134.3 ± 3.9

    1 --- 1 1 1 -1 *

    ED + NaCI ED + EPO ED + P-aB

    (2.5 ng / 100 g) (2.5 Mg / 100 g)

    Intact

    ED + NaCI

    ED + EPO (2.5 Mg / lCC g)

    ED + P-aB (2.5 Mg / lCC g)

    Figure 1 - Morphofunctional state of the vascular wall

    Note: A) Influence of EPO and P-aB on the endothelial dysfunction coefficient calculated as the ratio of the area above the pressure drop curve during endothelium-independent vasodilation to the area above the pressure drop curve in endothelium-dependent vasodilation; B) Histological picture of the abdominal aorta wall. Intact - Endothelial lining is continuous, endothelial cells are flat. There are no signs of swelling or infiltration. Architectonics is not broken, the ratio of layers is preserved. ED + 0.9% sodium chloride solution - There is swelling of the outer shell, round cell infiltration of the middle shell and vacuolar dystrophy of smooth myocytes. The cell density is high. The ratio of layers is changed in comparison with that of intact animals, endotheliocytes are swollen, most of them are exfoliated from the surface of the basal membrane. ED + EPO - Against the background of disturbances of the architectonics of the middle shell and the initial signs of fibrosis, polymorphocytic infiltration of the outer shell of the vessel is observed; ED + P-aB - In the preparation, a complete safety of the architectonics of the vessel wall layers is visualized. The endothelial lining iskept safe, and the endothelial cells are located on the basal membrane in one layer. There are no signs of pericellular and perivascular edema (stained with hematoxylin and eosin. X 400). * - p<0,05; ** - p<0,01.

    A

    B

    J4-, ^ DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    ФАРМАКОЛОГІЯ

    Histological picture of the aortic wall

    In the histological study, a similar trend characterizing the endothelial-protective activity of EPO and P-aB, was determined (Fig. 1B).

    - L-NAME + 0.9% sodium chloride solution. In the group of the animals with L-NAME-induced ED significant morphological changes in comparison with intact animals were revealed. They consisted in the presence of perivascular and pericellular edema signs, inflammation of all the membranes of the vessel wall (aorta). Single diapedemic haemorrhages were observed in the perivascular tissue, and there were mural microthrombi in the vascular lumen. In the area of ​​endothelial lining, there was swelling of endothelial cells and their exfoliating from the surface of the basal membrane. The nuclei were located along the wall of the blood vessel in small areas with the preserved endothelium. In single endothelial cells, karyolysis, vacuolization of cytoplasm and wrinkling of the cells were observed up to their death. There was a round cell infiltration of the middle and outer shells. Vacuolar dystrophy was observed in the middle shell, in smooth myocytes. In the outer shell, there was deflaking and signs of swelling. The density of the cells in both middle and outer shells was high.

    - L-NAME + EPO (2.5 ^ g / 100 g). In this group, polymorphocytic infiltration of the outer shell of the vessel was observed against the background of minor disturbances in the architectonics of elastic membranes, the presence of functionally active fibroblasts (cells with dark-basophilic cytoplasm, large sized, visualized in the center of the middle shell), which may indicate the initial signs of fibrosis. A small number of reactively altered smooth myocytes located between the elastic fenestrated membranes, were visualized. At the same time, the majority of endotheliocytes had a flattened form and were located continuously, their nuclei were oriented parallel to the basal membrane.

    - L-NAME + P-aB (2.5 ng / 100 g). In the study of histological slices in the group of the animals after the pharmacological correction by P-aB, almost a complete safety of the architectonics of the vessel wall layers was revealed. The ratio of the layer thicknesses did not differ visually from that in the intact group of the animals. The endothelial lining was kept safe, the endothelial cells were placed on the basal membrane in one layer, the cells were shaped flat, the cytoplasm was slightly oxyphilic. The stick-shaped nuclei were oriented along the blood vessel. No signs of pericellular or perivascular edema were visualized.

    A slightly increased cell density per unit of the section area was revealed, but it was without any signs of destruction, observed in the animals without pharmacological therapy.

    Expression of eNos, Tnf and Il-ip according

    to quantitative PCR

    When modeling L-NAME-induced ED in comparison with the intact animals, an increase in the relative expression of the eNos mRNA gene was revealed in all groups. At the

    same time, the eNOS expression grows in the following series: ED + 0.9% sodium chloride solution < ED + EPO < ED + P-aB. The level of proinflammatory cytokines mRNA genes Tnf and // - ip is characterized by the highest increase in the group of ED without therapy, and the use of EPO and P-aB reduces the degree of their expression (Fig. 2).

    Estimation of prothrombotic activity

    When estimating the time of the onset of ferric (III) chloride-induced thrombosis in the animals treated with EPO and P-aB for 8 days, a dose-dependent reduction of the thrombosis time was found out. A more significant prothrombotic effect was demonstrated by EPO, which reduced the thrombosis time to 16.7 ± 1.2 min. (2.5 ^ g / 100 g) and 14.2 ± 1.3 min. (5 ^ g / 100 g) compared to 19.5 ± 0.9 min. in the group not treated with any preparations. P-aB at the dose of 1.25 ^ g / 100 g did not significantly affect the thrombosis time, and at the dose of 2.5 ^ g / 100 g, it accelerated the carotid artery thrombosis time up to 16.2 ± 1.1 min. (Fig. 3).

    DISCUSSION

    Our work has shown that the 11-aminoacid peptide P-aB, which has a selective affinity to the heterodimeric receptor EPOR / CD131, is able to reduce the endothelial damage in the L-NAME-induced nitrogen oxide deficiency. The eNOS blockade led to persistent hypertension, which provoked morphological changes in the vessel wall. It was manifested in its hypertrophy, necrosis and architectonics disorders.

    With the use of a molecular-biological analysis, an increase in the mRNA expression of the eNos gene, which is probably a compensatory response to hypertension, has been found. At the same time, the level of the proinflammatory cytokine markers - TNF-a and IL-1P - has increased. The triple application of P-aB at the dose of 2.5 ^ g / 100 g did not affect arterial hypertension associated with the introduction of L-NAME, but led to a more pronounced increase in the expression of the eNos mRNA gene. This may be explained by the fact that P-aB has increased the number of functioning cells capable of synthesizing eNOS due to its antiapoptotic properties.It is noteworthy that in the EPO group, despite the decrease in EDC, the eNOS mRNA level did not significantly increase with respect to the control. This is consistent with the data obtained by Sultan F. et al. showing that EPO is capable of suppressing the expression of eNOS [19]. Apparently, this property qualitatively distinguishes the vasotropic activity of P-aB from other erythropoietin preparations.

    The results obtained also show that P-aB is able to prevent an inflammatory activation in the L-NAME-induced ED model. This phenomenon is most likely associated with both the antiapoptotic activity of the compound and the intrinsic anti-inflammatory activity of erythropoietin molecules. This property is very important for the potential atheroprotector, as a decrease in the cytokine activation is necessary to stabilize the atherosclerotic plaque and prevent its rupture.

    ISSN 2307-9266 e-ISSN 2413-2241

    PHARMACY& PHARMACOLOGY

    eNos

    i-

    **

    h

    in

    OL

    E

    CO.

    4 3,5 3 2,5 2 1,5 1 0,5 0

    ll-lp

    h ^ hi --- 1

    ED + NaCI

    ED + NaCI

    B c

    Figure 2 - Influence of EPO and P-aB on the expression of eNos, Tnf, and Il-1? mRNA genes in the abdominal aorta against the background of L-NAME-induced ED modeling (based on quantitative PCR data)

    Note: * - p<0,05; ** - p<0,01.

    25 20 15 10 5 0

    (2.5 Mg / 100 g) (5 Mg / 100 g) (2.5 Mg / 100 g) (5 Mg / 100 g)

    Figure 3 - Influence of EPO and P-aB on the time of FeCl3-induced thrombotic occlusion of the carotid artery (reduction of Doppler signal to the level of = 10% from the initial one)

    Note: * - p<0,05.

    ФАРМАЦІЯ І ФАРМАКОЛОГІЯ

    ОРИГІНАЛЬНА СТАТТЯ

    DOI: 10.19163 / 2307-9266-2019-7-6-312-320

    Finally, the last stage of the study with the use of FeCl3-induced carotid artery thrombosis in the rats has revealed that P-aB has prothrombotic properties. The prothrombotic activity of P-aB is less pronounced than that of EPO and has not appeared in the doses at which it demonstrates an endothelial-protective action (2.5 ^ g / 100g x 3 for 7 days). However, this property is a significant limitation in the positioning of P-aB as a preventing and treating agent for cardiovascular diseases associated with atherosclerosis.

    We see a perspective in the modification of P-aB by adding peptide motifs with an antiaggregant activity. To eliminate a prothrombotic activity, the amino acid sequences Arg-Gly-Asp and Lys-Gly-Asp, can be added to P-aB. Arg-Gly-Asp and Lys-Gly-Asp are known to have pronounced antiaggregant properties [20-22]. In a number of domestic studies, antithrombotic and antiplatelet properties of another auxiliary amino acid tripeptide, Pro-Gly-Pro, have also been revealed [2325]. In addition, Pro-Gly-Pro stabilizes the molecule in the biological environment by inhibiting the activity of proteolytic enzymes [26] and has the ability to block

    angiotensin-converting enzyme [27], one of the most important proatherogenic factors that catalyzes the reaction of angiotensin II formation and promotes vascular wall remodeling [28].

    The character (position, linkers, etc.) for the amino acid sequences in the base molecule still remains the key problem. The bioinformatics analysis will make it possible to determine the most optimal localizations for the tripeptide addition, allowing not to influence the interesting pharmacophores, preserving both endothelial-protective and antiplatelet kinds of activity.

    CONCLUSION

    The 11-amino acid peptide imitating erythropoietin a-helix B, has a pronounced endothelial-protective and potentially atheroprotective effect due to its ability to prevent the death of endothelial cells, as well as to reduce remodeling and pro-inflammatory activation of the vascular wall . However, the prothrombotic activity of P-aB limits its use as a preventing and treating agent for atherosclerosis-associated diseases and necessitates further modifications of this molecule.

    FINANCIAL SUPPORT

    The work is supported by the Russian Ministry of Education and Science. Subsidy Agreement No. 05.605.21.0109 (unique agreement identifier RFMEFI60519X0191).

    AUTHORS 'CONTRIBUTION M.V. Korokin - writing the article, the development of the research design, a sample preparation for the histological study, a morphological description of aortic wall sections; V.O. Soldatov - writing the article, developing a research design; Alesia A. Tietze - peptide synthesis, literature analysis; I.V. Golubev - the administration of drugs to animals, modeling a L-NAME-induced endothelial dysfunction; A.E. Belykh - mRNA isolation, reverse transcription reaction, analysis of mRNA expression of eNos, Tnf and Il-10 genes, translation of the article. M.V. Kubekina - mRNA isolation, reverse transcription reaction, analysis of mRNA expression of eNos, Tnf, and Il-10 genes, formalization of the literature list, work with graphic material; O.A. Puchenkova - work with the animals in all stages, separation of RNA, sampling for histological study. T.A. Denisyuk - participation in the evaluation of the endothelial dysfunction coefficient; V.V. Gureyev - estimation of the endothelial dysfunction coefficient; T.G. Pokrovskaya - consultation on planning, methodology and implementation of the experiment; O.S. Gudyrev -prothrombotic activity assessment, literature analysis; M.A. Zhuchenko - peptide synthesis, literature analysis; M.A. Zatolokina - preparation of samples for histological examination, morphological description of aortic wall sections; M.V. Pokrovskiy - the idea, research planning, consultation on the implementation of the individual phases of the pilot works.

    CONFLICT OF INTERESTS

    The authors declare no conflict of interest.

    REFERENCES

    1. Glushko AA, Voronkov AV, Chernikov MV. Molecular targets in the search for endothelium-protecting compounds. Russian Journal of Bioorganic Chemistry. 2014; 40 (5): 477-87. DOI: 10.1134 / S1068162014050069

    2. Tyurenkov IN, Voronkov AV, Slietsans AA, Volotova EV. Endothelial protection drugs - a new class of pharmacological agents. Annals of the Russian academy of medical sciences. 2012; 67 (7): 50-7. DOI: https://doi.org/10.15690/vramn.v67i7.341 (in Russ)

    3. Zarate A, Manuel-Apolinar L, Basurto L, De la Chesnaye E, Saldivar I. Cholesterol and atherosclerosis. Historical considerations and treatment. Arch Cardiol Mex. 2016 року; 86 (2): 163-9. doi: 10.1016 / j. acmx.2015.12.002.

    4. Orekhov AN, Poznyak AV, Sobenin IA, Nikifirov NN, Ivanova EA. Mitochondrion as a selective target for treatment of atherosclerosis: Role of mitochondrial DNA mutations and defective

    mitophagy in the pathogenesis of atherosclerosis and chronic inflammation. Curr Neuropharmacol. 2019. doi: 10.2174 / 1 570 159X17666191118125018.

    5. Marzetti E, Calvani R, Cesari M, Buford TW, Lorenzi M, Behnke BJ Leeuwenburgh C. Mitochondrial dysfunction and sarcopenia of aging: from signaling pathways to clinical trials. Int J Biochem Cell Biol. 2013; 45 (10): 2288-301. doi: 10.1016 / j.biocel.2013.06.024.

    6. Voronkov AV, Pozdnyakov DI, Miroshnichenko KA, Potapova AA. Influence of New Pyrimidine Derivatives on Vasodilatory Cerebrovascular Endothelial Function under Conditions of Chronic Traumatic Encephalopathy. Experimental and Clinical Pharmacology. 2019; 82 (11): 11-4. DOI: 10.30906 / 0869-2092-2019-82-11-11-14.

    7. Voronkov AV, Pozdnyakov DI. Evaluation of the Influence of 4-Hy-droxy-3,5-di-tert-butylcinnamic Acid on the Antithrobomic Potential of Endothelium in Rabbits under Conditions of Brain Ischemia. Experimental and Clinical Pharmacology. 2018; 81 (8): 3-7. DOI: 10.30906 / 0869-2092-2018-81-8-3-7

    ISSN 2307-9266 e-ISSN 2413-2241

    PHARMACY& PHARMACOLOGY

    8. Gimbrone MA Jr, Garcia-Cardena G. Endothelial cell dysfunction and the pathobiology of atherosclerosis. Circ Res. 2016 року; 118 (4): 620-636. doi: 10.1161 / aRCRESAHA.115.306301.

    9. Elagin, VV, Bratchikov OI, Ulyanova AA. Approaches to correction of ischemic and reperfusion kidney injuries in experiment. Nauchnyye rezul'taty biomeditsinskikh issledovaniy. 2018; 4 (3): 3-69. doi: 10.18413 / 2313-8955- 2018-4-3-0-6 (in Russ).

    10. Shabelnikova AS, Lutsenko VD, Pokrovskii MV, Peresipkina AA, Korokin MV, Gudyrev OS, Hoshenko YA. Protective effects of recombinant erythropoietin in ischemia of the retina: The role of mechanisms of preconditioning. Research Journal of Medical Sciences. 2015; 9 (4): 200-203. doi: 10.3923 / rjmsci.2015.200.203.

    11. Korokina LV, Kolesnik IM, Pokrovskiy MV, Korokin MV, Belous AS, Artjushkova EB, Pokrovskaya TG, Gudyrev OS, Korolev AE, Pavlova LA, Novikov OO. Pharmacological correction of L-nAME induced nitric oxide deficiency with recombinant erythropotin. Kubanskiy nauchnyy meditsinskiy vestnik. 2009 року; 9 (114): 66-69 (in Russ).

    12. Denisyuk T. Pharmacotherapeutic strategies for endothelial dysfunction correction with use of statins in syndrome of systemic inflammatory response. Research Results in Pharmacology. 2017; 3 (4): 35-77. doi: 10.18413 / 2313-8971-2017-3-4-35-77.

    13. Denisyuk TA, Pokrovskiy MV. Combined use of recombinant eryth-ropoietin and statins in endotoxin induced endothelial dysfunction. Allergologiya i immunologiya. 2016 року; 17 (1): 64-65 (in Russ.)

    14. Rajkumar DSR, Gudyrev OS, Faiteison AV, Pokrovskii MV. Study of the microcirculation level in bone with osteoporosis and os-teoporotic fractures during therapy with recombinant erythro-poietin, rosuvastatin and their combinations. Research result: pharmacology and clinical pharmacology. 2015; 4 (6): 57-60. doi: 10.18413 / 2313-8971-2015-1-4-57-60.

    15. Souvenir R, Doycheva D, Zhang JH, Tang J. Erythropoietin in stroke therapy: friend or foe. Curr Med Chem. 2015; 22 (10): 1205-13.

    16. Pearl Rg. Erythropoietin and organ protecttion: lessons from negative clinical trials. Crit Care. 2014; 18 (5): 526. doi: 10.1186 / s13054-014-0526-9.

    17. Brines M, Grasso G, Fiordaliso F, Sfacteria A, Ghezzi P, Fratelli M, Latini R, Xie QW, Smart J, Su-Rick CJ, Pobre E, Diaz D, Gomez D, Hand C, Coleman T, Cerami A. erythropoietin mediates tissue protection through an erythropoietin and common beta-subunit heteroreceptor. Proc Natl Acad Sci USA. 2004; 101 (1): 14907-12. doi.org/10.1073/pnas.0406491101.

    18. Brines M, Patel NS, Villa P, Brines C, Mennini T, De Paola M, Erbayraktar Z, Erbayraktar S, Sepodes B, Thiemermann C, Ghezzi P, Yamin M, Hand CC, Xie QW, Coleman T, Cerami A. Nonerythropoi-

    etic, tissue-protective peptides derived from the tertiary structure of erythropoietin. Proc Natl Acad Sci U S A. 2008; 105 (31): 10925-30. doi: 10.1073 / pnas.0805594105.

    19. Sultan F, Singh TU, Kumar T, Rungsung S, Rabha DJ, Vishwakarma A, Sukumaran SV, Kandasamy A, Parida S. Short-term exposure of erythropoietin impairs endothelial function through inhibition of nitric oxide production and eNOS mRNA expression in the rat pulmonary artery. Pharmacol Rep. 2017; 69 (4): 658-665. doi: 10.1016 / j.pharep.2017.02.003.

    20. Pytela R, Pierschbacher MD, Ginsberg MH, Plow EF, Ruoslahti

    E. Platelet membrane glycoprotein IIb / IIIa: member of a family of Arg-Gly-Asp - specific adhesion receptors. Science. 1986; 231 (4745): 1559-62. doi: 10.1126 / science.2420006.

    21. Sheu JR, Yen MH, Peng HC, Chang MC, Huang TF. Triflavin, an Arg-Gly-Asp-containing peptide, prevents platelet plug formation in in vivo experiments. Eur J Pharmacol. 1995; 294 (1): 231-8. doi: 10.1016 / 0014-2999 (95) 00530-7.

    22. Hung YC, Kuo YJ, Huang SS, Huang TF. Trimucrin, an Arg-Gly-Asp containing disintegrin, attenuates myocardial ischemia-reperfu-sion injury in murine by inhibiting platelet function. Eur J Pharmacol. 2017; 813: 24-32. doi: 10.1016 / j.ejphar.2017.07.039.

    23. Pastorova VE, Liapina LA, Alshmarin IP, Ostrovskaia PU, Guda-sheva TA, Lugovskoi EV. Fibrin-depolymerization activity and the antiplatelet effect of small cyclic and linear proline-containing peptides. Izv Akad Nauk Ser Biol. 2001; 5: 593-6.

    24. Lyapina LA, Pastorova VE, Obergan TY. Changes in hemostatic parameters after intranasal administration of peptide Pro-Gly-Pro. Bull Exp Biol Med. 2007; 144 (4): 491-3. doi: 10.1007 / s10517-007-0358-6.

    25. Liapina LA, Grigor'eva ME, Andreeva LA, Miasoedov NF. Protective antithrombotic effects of proline-containing peptides in the animal body subjected to stress. Izv Akad Nauk Ser Biol. 2010 року; 4: 462-7.

    26. Shevchenko KV, Nagaev IY, Andreeva LA, Shevchenko VP, My-asoedov NF. Stability of prolin-containing peptides in biological media. Biomed Khim. 2019; 65 (3): 180-201. doi: 10.18097 / PBMC20196503180.

    27. Wang Z, Zhang S, Jin H, Wang W, Huo J, Zhou L, Wang Y, Feng

    F, Zhang L. Angiotensin-I-converting enzyme inhibitory peptides: Chemical feature based pharmacophore generation. Eur J Med Chem. 2011 року; 46 (8): 3428-33. doi: 10.1016 / j.ejmech.2011.05.007.

    28. Montezano AC, Nguyen Dinh Cat A, Rios FJ, Touyz RM. Angiotensin II and vascular injury. Curr Hypertens Rep. 2014; 16 (6): 431. doi: 10.1007 / s11906-014-0431-2.

    AUTHORS

    Mikhail V. Korokin - Doctor of Sciences (Medicine), Associate Professor, Professor of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University. ORCID ID: 0000-0001-5402-0697. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Vladislav O. Soldatov - Assistant of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University.ORCID ID: 0000-0001-9706-0699. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Alesia A. Tietze - Senior Lecturer (Assistant Professor) in Medicinal Chemistry with focus on total synthesis of bioactive peptides, Department of Chemistry and Molecular Biology, Division of Organic and Medicinal Chemistry, University of Gothenburg. ORCID ID: 0000-0002-9281-548X. f-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Ivan V. Golubev - Applicant of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University. ORCID ID: 0000-0002-3754-0380. E-mail: golubevvano @ yandex.org.ua

    Andrey E. Belykh - Candidate of Sciences (Medicine), Associate Professor of Pathophysiology Department, Kursk State Medical University. ORCID ID: 0000-0001-9766-2104. E-mail: a.e.belykh @ gmail.com

    Marina V. Kubekina - Post-Graduate Student, Institute of Gene Biology of the Russian Academy of Sciences. ORCID ID: 0000-00028834-1111. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Olesya A. Puchenkova- 5th - year student at the Medical Institute, Belgorod State National Research University. ORCID ID: 00000002-7657-0937. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Tat'yana A. Denisyuk - Doctor of Sciences (Medicine), Associate Professor of the Pharmacology Department, Kursk State Medical University. ORCID ID: 0000-0003-0974-4818. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Vladimir V. Gureyev - Doctor of Sciences (Medicine), Associate Professor of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University. ORCID ID: 0000-0003-1433-1225. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Tat'yana G. Pokrovskaya - Doctor of Sciences (Medicine), Professor of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University. ORCID ID: 0000-0001-6802-5368. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Oleg S. Gudyrev - Candidate of Sciences (Medicine), Associate Professor, Associate Professor of the Department of Pharmacology and Clinical Pharmacology, Belgorod State National Research University. ORCID ID: 0000-0003-0097-000X. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Maksim A. Zhuchenko - Candidate of Sciences (Biology), the Section Chief, Kurchatov Institute. E-mail: maksim.zhuchenko @ pharmapark.org.ua

    Mariya A. Zatolokina - Doctor of Sciences (Medicine), Associate Professor, Professor of the Department of Histology, Cytology, Embryology, Kursk State Medical University. ORCID ID: 0000-00029553-1597. f-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.

    Mikhail V. Pokrovskiy - Doctor of Sciences (Medicine), Professor of the Department of Pharmacology and Clinical Pharmacology, the Head of the Research Institute of Pharmacology of Living Systems, Belgorod State National Research University. ORCID: 0000-0002-27616249. E-mail: Ця електронна адреса захищена від спам-ботів. Вам потрібно увімкнути JavaScript, щоб побачити її.


    Ключові слова: atherosclerosis / erythropoietin / rats / P-? B / cibenitide / endothelium / атеросклероз / еритропоетин / щури / P-? B / цібенітід / ендотелій

    Завантажити оригінал статті:

    Завантажити